Labshake search
Citations for Agilent :
251 - 300 of 3642 citations for 8 chloro 10 3 dimethylamino propyl phenothiazin 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). Each compound was assessed in triplicate ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Neuroscience 2020Quote: ... incubated with DAPI (1:10’000) to label nuclei for 10 min and mounted using Fluorescence mounting medium (Dako, S3023). Fluorescent images were recorded with a Leica SP5 Confocal Microscope.
-
bioRxiv - Immunology 2022Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). Basal OCR and ECAR were measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding the single-mutation variants found in P.1 and 10-mutation variant (BZΔ10) were generated by Quikchange II XL site-directed mutagenesis kit (Agilent). Recombinant Indiana VSV (rVSV ...
-
bioRxiv - Immunology 2020Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). OCR was measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Immunology 2021Quote: ... and a 1:10 dilution of the resulting cDNA was run on a Fragment Analyzer (Agilent Technologies #5067-4626) to assess cDNA quality and yield ...
-
bioRxiv - Immunology 2022Quote: ... and a 1:10 dilution of the resulting cDNA was run on a Fragment Analyzer (Agilent Technologies #5067-4626) to assess cDNA quality and yield ...
-
bioRxiv - Immunology 2024Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). OCR was measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Immunology 2024Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). Oxygen consumption rates (OCR ...
-
bioRxiv - Cancer Biology 2019Quote: ... For 8 other samples (1 normal and 3 tumor regions each from 2 patients) only DNA was isolated and targeted panel sequencing (Agilent SureSelect run on a HiSeq) was performed for 257 genes ...
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
bioRxiv - Neuroscience 2023Quote: ... Data were analyzed using Masshunter Qualitative Analysis 10 and Profinder 10 (Agilent Technologies).
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... 0.75 μg labeled cRNA was fragmented and hybridized to custom whole-genome human 8 × 60K microarrays (Agilent-048908) according to the supplier’s protocol (Agilent Technologies) ...
-
bioRxiv - Developmental Biology 2022Quote: ... a genome-wide gene expression profiling was set up using the 8×60K ArrayXS Zebrafish platform by Agilent and performed by OakLabs GmbH (Henningsdorf ...
-
bioRxiv - Neuroscience 2020Quote: ... Cy3-labeled RNAs were hybridized to SurePrint G3 Mouse Gene Expression v2 8×60K Microarray Kit (Agilent Technologies) at 65 °C for 17h ...
-
bioRxiv - Cancer Biology 2021Quote: ... rinsed with water and then blocked in a serum-free protein block buffer for 8 min (Dako, X0909). Primary CD133 antibody (Miltenyi Biotec ...
-
bioRxiv - Molecular Biology 2022Quote: Single color Agilent SurePrint G3 Custom Gene Expression Microarray 8 x 60K (Agilent, Agilent-048908; GEO Platform GPL21272) was used for gene expression analysis according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: The complete RNA library was hybridised to SurePrint G3 Mouse GE 8×60K Microarrays (Agilent, Cat No. G4852A) using a partially modified version of manufacturer’s protocol as described in Version 6.9.1 of ‘One-Color Microarray-Based Gene Expression Analysis Protocol’ ...
-
bioRxiv - Microbiology 2021Quote: ... Oligonucleotide microarrays for human whole genome (G4858A design 072363, 8×60k chips SurePrint G3 unrestricted GE, Agilent Technologies) were used for global gene expression analysis ...
-
bioRxiv - Genomics 2021Quote: Submicroscopic CNVs were identified in patients referred for genetic diagnosis through the 8×60k ISCA platform (Agilent Technologies), with a mean actual resolution of about 120 kb ...
-
bioRxiv - Genetics 2019Quote: DNA from patient LA was tested using an 8 x 60K SurePrint G3 custom CGH + SNP microarray (Agilent) and analysed using Agilent Cytogenomics software 4.0 ...
-
bioRxiv - Molecular Biology 2022Quote: Single color Agilent SurePrint G3 Custom Gene Expression Microarray 8 x 60K (Agilent, Agilent-048908; GEO Platform GPL21272) was used for gene expression analysis according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... The Cy3-labeled aRNA was hybridized overnight to 8 x 60K 60-mer oligonucleotide spotted microarray slides (Agilent Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... Growth was monitored by measuring OD600 every 2.5 min for 8 hours using a BioTek 800 TS (Agilent) with continuous ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quick Amp Labeling Kit and SurePrint G3 Human Gene Expression 8×60Kv3 Microarray (Cat. No. G4851C, Agilent Technologies) was used corresponding to the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA integrity was assessed using an Agilent 2100 Bioanalyzer (cutoff value of RIN 8 or higher; Agilent Technologies). cDNA libraries were clustered onto a TruSeq paired-end flow cell ...
-
bioRxiv - Microbiology 2023Quote: ... 1.8 μm) and a guard column Zorbax Eclipse Plus C18 (2.1 × 5mm, 1.8 μm) both provided by Agilent technologies (Santa Clara ...
-
bioRxiv - Cell Biology 2023Quote: ... OCR and ECAR were measured using an 8-well Seahorse XFp Analyzer according to manufacturer’s instructions (Agilent Technologies). In brief ...
-
bioRxiv - Neuroscience 2023Quote: Recombinant adeno-associated viruses (AAVs) with serotype 8 were produced using the AAV helper-free system (Agilent Technologies). Human embryonic kidney (HEK ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples with RNA integrity numbers (RINs)<8 were excluded (TapeStation automated sample processing system, Agilent, Santa Clara, CA). A DNA library targeting polyadenylated transcripts was constructed for each sample in a 12-cycle PCR (100ng total RNA ...
-
bioRxiv - Cell Biology 2024Quote: ... CENTB-FAM (PNAbio; F3006) and Telomere TelG-Cy3 (PNA FISH kit, Dako Agilent; K532611-8 or PNAbio; F1006). A coverslip (18x18mm ...
-
bioRxiv - Cell Biology 2024Quote: ... CENTB-FAM (PNAbio; F3006) and Telomere TelG-Cy3 (PNA FISH kit, Dako Agilent; K532611-8 or PNAbio; F1006). A coverslip (18x18mm ...
-
bioRxiv - Cell Biology 2021Quote: ... 5% or 10% milk overnight followed by 1 hour incubation with the indicated primary antibodies followed by HRP conjugated secondary antibodies (Dako) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... Converted libraries were enriched by 10 cycles of PCR with the following reaction composition: 1 μl Pfu TurboCx Hotstart DNA polymerase (Stratagene), 5 μl PfuTurbo Cx reaction buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... Free-floating sections were thoroughly washed with 0.3% Triton-TBS followed by antigen retrieval with target retrieval solution citrate pH6 (1:10, Dako S2031) for 20 minutes at 80°C ...
-
bioRxiv - Plant Biology 2019Quote: ... The digest was acidified by adding formic acid to a final concentration of ~ 1 % and desalted using OMIX C18 pipette tips (10 – 100 μL, Agilent). C18 desalting tips were first activated by twice aspiring and discarding 200 μl buffer B2 (0.1 % formic acid ...
-
bioRxiv - Neuroscience 2024Quote: ... The cells were washed once with DMEM Assay Medium (XF DMEM [Agilent] supplemented with XF glucose [10 mM, Agilent], XF glutamine [2 mM, Agilent] and XF pyruvate [1 mM, Agilent]), then left in DMEM Assay Medium and placed in a non-CO2 incubator for 1 hour ...
-
bioRxiv - Biochemistry 2023Quote: ... Shimadzu LC-10AT; autosampler: HiP sampler G1367A, T = 4°C, 10 µL injection; flow rate: 1 mL/min; column: Agilent Zorbax Eclipse XDB-C18 80Å ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed with a 3-laser flow cytometer (Agilent Novocyte) and data were processed with FlowJo (v10.1) ...