Labshake search
Citations for Agilent :
151 - 200 of 1128 citations for 4' O beta Glucopyranosyl 5 O methylvisamminol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... every 2nd day with a Cytation 5 instrument (Agilent Technologies). On day 7 ...
-
bioRxiv - Cell Biology 2024Quote: ... Plates were read using a BioTek Cytation 5 (Agilent Technologies) wide-field imaging reader with a 20x air objective ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Plant Biology 2020Quote: ... Hybridizations were done using a custom 4×44 k oligoarray (Agilent Technologies) that was previously described15,25 ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 4°C overnight diluted 1:200 in antibody diluent (#S3022, Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×180K or 8×60K SurePrint G3 human CGH microarray (Agilent Technologies) according to manufacturer’s instructions (CGH enzymatic protocol v6.2 ...
-
bioRxiv - Immunology 2020Quote: ... FLAG-tagged YTHDF1 was cloned into pCMV-Tag 4 vector (Agilent, #211174); Myc-tagged DDX60 was cloned into pRK-5 vector (BD PharMingen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sections were incubated at 4°C with anti-VWF (1:200, Dako) and anti-α-smooth muscle actin (1:100 ...
-
bioRxiv - Genomics 2021Quote: ... diluted to 4 nM and QC’d on the Bioanalyzer (Agilent Technologies, USA). The final pool was sequenced on Illumina MiSeq platform 2×300 bp using the MiSeq Reagent Kit V3 (600 cycles PE ...
-
bioRxiv - Neuroscience 2024Quote: ... PSCs were then labeled with a S100 rabbit antibody (1:4, DAKO) for 2 h at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... Wall air was passed through a hydrocarbon filter (Agilent Technologies, HT200-4) and split into a 100 mL/min odor stream and 900 mL/min carrier stream using analog flowmeters (Cole-Parmer ...
-
bioRxiv - Physiology 2023Quote: ... at 4 °C overnight and mounted with fluorescence mounting medium (Agilent, USA).
-
bioRxiv - Immunology 2023Quote: ... 4 μM oligomycin and 50 mM 2-DG (Agilent, Cat# 103020-100).
-
bioRxiv - Developmental Biology 2024Quote: ... The signal was detected with BioTek Synergy 4 Microplate reader (Agilent Technologies), and the results were analyzed using a 4-parameter logistic regression algorithm (http://www.elisaanalysis.com/app) ...
-
bioRxiv - Biochemistry 2024Quote: ... overnight at 4 °C) and blocking of endogenous peroxidase (peroxidase block; Dako) for 10 min at RT ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5-μm sections were obtained and stained with hematoxylin (Dako) and eosin (VWR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples with RIN values > 5 as assessed by TapeStation (Agilent Technologies) were prepared with KAPA mRNA HyperPrep kit (Roche) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Data were collected on a Cytation 5 plate reader (Agilent Technologies) using a green fluorescent polarization filter (excitation and emission wavelengths of 485 nm and 528 nm ...
-
bioRxiv - Neuroscience 2022Quote: ... Images were obtained using a Biotek Cytation 5 Multimode Reader (Agilent) to generate (at minimum ...
-
bioRxiv - Immunology 2020Quote: ... FBXO10 E54K was generated by site-directed mutagenesis (Stratagene 200521-5) using the following primers:
-
bioRxiv - Systems Biology 2022Quote: ... and desalted via 5 μg C18 columns on an AssayMap (Agilent) following the standard protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... chamber slides were scanned with an automated microscope (Cytation 5, Agilent) with a 4x objective and filters for high-contrast brightfield and GFP fluorescence ...
-
bioRxiv - Cell Biology 2023Quote: ... and Sialidase A (5 mU, Prozyme/Agilent, Santa Clara, CA, USA) overnight at 37°C in order to deglycosylate peptides (Larsen et al ...
-
bioRxiv - Cell Biology 2023Quote: ... and Sialidase A (5 mU, Prozyme/Agilent, Santa Clara, CA, USA) overnight at 37°C in order to deglycosylate peptides (Larsen et al ...
-
bioRxiv - Neuroscience 2022Quote: ... Images were acquired on a Biotek Cytation 5 Multimode Reader (Agilent) with the same gains and exposure across all animals for each stain ...
-
bioRxiv - Bioengineering 2024Quote: ... Cell invasion depth was measured using Gen 5 software (Agilent Technologies), and endothelial microvessel formation was quantified by measuring the average microvessel length at each time point with Fiji (NIH ...
-
bioRxiv - Microbiology 2023Quote: ... We exported bacterial growth data from the software (Gen 5, Agilent Technologies ...
-
bioRxiv - Immunology 2023Quote: ... using the Cytation 5 Cell Imaging Reader (Agilent BioTek, CA, USA). Lactate levels present in the samples were estimated from the standard curve.
-
bioRxiv - Cell Biology 2022Quote: ... both solvents containing 5 µM Infinity Lab deactivator additive (Agilent Technologies). The elution gradient used was as follows ...
-
bioRxiv - Bioengineering 2022Quote: ... with a 5-Å column (Agilent, 25m x 0.25mm x 30μm). Hydrogen that evolved during the BPEC stabilization stage (see previous section ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a carbohydrate column (4.6 × 150 mm, 5 μm, Agilent Technologies). The sugar concentrations were quantified according to a standard solution (Sigma ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... held for 5 min and connected to the GC-MS (Agilent 7890B GC and 5977 MS ...
-
bioRxiv - Molecular Biology 2024Quote: ... liquid handler and AssayMAP 5 µL C18 cartridges (Agilent 5190-6532). Cartridges were primed with 100 µL of priming buffer (0.1% TFA ...
-
bioRxiv - Microbiology 2024Quote: Fixed-cell images were obtained on a BioTek Cytation 5 (Agilent) using a 4X (NA=0.13 ...
-
bioRxiv - Microbiology 2024Quote: ... Infected (eGFP-positive) cells were imaged on a Cytation-5 (Agilent) and automatically enumerated using the onboard Gen5.0 software to calculate titers of the stocks ...
-
bioRxiv - Immunology 2024Quote: ... Absorbance was measured using a Cytation 5 imaging reader (Agilent Technologies) at 450 nm ...
-
bioRxiv - Biochemistry 2024Quote: ... Site-directed mutagenesis with the QuickChange Lightning kit (Agilent, 210518-5) was used to remove the mitochondrial targeting sequence (amino acids 1-33 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and tumour DNA was labelled with cyanine 5-dUTP (Agilent Technologies). After clean-up ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were imaged on a Cytation 5 imaging reader (Agilent Technologies) using DAPI ...
-
bioRxiv - Cell Biology 2024Quote: ... Signal was detected with a Biotek Cytation 5 plate reader (Agilent). For Legendplex assays ...
-
bioRxiv - Cancer Biology 2024Quote: ... using an Cytation 5 Cell Imaging Multi-Mode Reader (Agilent Technologies). 2µM Staurosporine (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2024Quote: ... Luminescence was measured in a Cytation 5 plate reader (Agilent Technologies).
-
bioRxiv - Immunology 2022Quote: ... pooled at 4 nM and quality-assessed on a 2100 Bioanalyzer (Agilent Technologies). Sequencing was performed on an Illumina MiSeq (paired-end ...
-
bioRxiv - Cancer Biology 2020Quote: ... SureFISH chr4 CEP 613kb green for the centromere of chromosome 4 (#G101066G, Dako), FISH RAMP1 red for the RAMP1 gene (#G110996X-8 ...
-
bioRxiv - Immunology 2021Quote: ... Cy-dye labelling and hybridization to Agilent High Definition 4×44k array (Agilent technologies ...
-
bioRxiv - Immunology 2023Quote: ... mCTLA-4 cDNA was sub-cloned into the pCMV-Tag4A vector (Agilent Technologies) and an exon3 deletion construct was made by the KOD Plus Mutagenesis Kit (TOYOBO) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with small RNA ladder (4-150nt) were used (cat no. 5067-1550, Agilent), all accessory reagents were also from Agilent (cat no ...
-
bioRxiv - Immunology 2023Quote: ... The tissue was then incubated overnight at 4°C with anti-CD4 (Dako) in a 1:10 dilution ...
-
bioRxiv - Physiology 2022Quote: ... We used a Mouse Gene Expression 4 × 44K Microarray chip (G4846A, Agilent Technologies), which can examine 23,215 genes as described [30] ...
-
bioRxiv - Immunology 2024Quote: ... Each sample was run on a 4% agarose gel and TapeStation 4150 (Agilent) to verify the presence of PCR products of the appropriate size (383 bp) ...