Labshake search
Citations for Agilent :
101 - 150 of 1128 citations for 4' O beta Glucopyranosyl 5 O methylvisamminol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2021Quote: ... with a Bio SEC-5 2000 Å guard (Agilent). The mobile phase was PBS ...
-
bioRxiv - Systems Biology 2022Quote: ... equipped with a VF-5 ms column (Agilent Technologies) of 30 m length ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µM medronic acid (5191-4506, Agilent Technologies). For positive mode analysis ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μm particle size (Zorbax XDB C8, Agilent Technologies). The analytes were eluted using a gradient starting with 50% mobile phase B that increased to 98% within 2.3 min and was held for 1.0 min ...
-
bioRxiv - Cell Biology 2024Quote: ... QuikChange II Site-Directed Mutagenesis Kit (Agilent, 200523-5) was used for mutagensis of GFP-VPS35L constructs following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse phase-S cartridges (Agilent, 5 μL bed volume) were primed with 250 μL 99.9% acetonitrile (ACN ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 μl SYBR green (Agilent Technologies, CA, United States), and 2 μl nuclease-free water ...
-
bioRxiv - Developmental Biology 2023Quote: ... for 5’ and mounted with fluorescent mounting medium (Dako). The Lmx1a antibody detection capability was improved using the Tyramide Signal Amplification kit (TSA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
bioRxiv - Immunology 2023Quote: Images were acquired with a Biotek Cytation 5 (Agilent) and images were analyzed with Biotek Gen5 software ...
-
bioRxiv - Neuroscience 2024Quote: ... Reverse phase S cartridges (Agilent, 5 μL bed volume) were primed with 250 μL 99.9% acetonitrile (ACN ...
-
bioRxiv - Molecular Biology 2024Quote: ... and analyzed by Cytation 5 (Agilent, CA, United States). Cells seeded in 6-well plates were used for PCR or Western Blotting.
-
bioRxiv - Microbiology 2024Quote: ... in digital wide-field microscopy (BioTek Cytation 5, Agilent). Automated Image capturing was performed at 10 minute intervals using a 10X objective and the BioTek Gen5 Software ...
-
bioRxiv - Microbiology 2024Quote: ... and luminescence measured on a Cytation 5 instrument (Agilent). The luminescence inhibited by Z-YVAD-FMK corresponds to specific caspase-1 activity ...
-
bioRxiv - Bioengineering 2024Quote: ... Sections were imaged using Biotek Cytations 5 (Agilent Technologies).
-
bioRxiv - Cancer Biology 2024Quote: ... Reverse phase S cartridges (Agilent, 5 μL bed volume) were primed with 250 μL 99.9% acetonitrile (ACN ...
-
bioRxiv - Cancer Biology 2024Quote: ... Luminescence was measured using the Cytation 5 (Agilent Technologies).
-
bioRxiv - Cancer Biology 2021Quote: ... 4 µm tissue sections were stained and developed using AutostainerPlus (Dako). Antibodies were diluted in block solution and sections were incubated for 30 minutes with primary antibody and 20 minutes with secondary antibodies ...
-
bioRxiv - Synthetic Biology 2020Quote: ... or Streptococcus pneumoniae β-N-Acetylhexosaminidase (Prozyme, 4 mU per digest) overnight at 37°C in 20 mM sodium acetate (pH 5.0).
-
bioRxiv - Cell Biology 2021Quote: ... overnight at 4°C after blocking with blocking solution (S3022, Dako) for 30 min ...
-
bioRxiv - Genetics 2020Quote: ... at 4°C followed by secondary antibody (Dako Cytomation, Glostrup, Denmark) for 30 min at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... elegans (V2) Gene Expression Microarray 4 × 44k chips were used (Agilent). Scanning was done with an Agilent High Resolution C Scanner ...
-
bioRxiv - Biochemistry 2023Quote: ... Absorbance was measured using a BioTek Synergy 4 plate reader (Agilent).
-
bioRxiv - Immunology 2022Quote: ... overnight at 4°C in Dako REAL antibody diluent (Dako, S2022). To visualized the specific signal ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μL of TEDAP (4 μM) underwent reverse-phase HPLC (Agilent PLRP- S reversed phase column 3.0 μM ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3% Triton X-100 with 5% Goat Serum (Dako #X090710)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-mouse-HRP at 5 µg/ml (Dako, Cat # P0447).
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’-dimethoxytrityl group was retained for HPLC purification (Agilent PLRP-S column ...
-
bioRxiv - Microbiology 2024Quote: ... and the plates were read with a Cytation 5 (Agilent) plate reader ...
-
bioRxiv - Immunology 2024Quote: ... endogenous peroxidases were blocked for 5 minutes (Agilent, ref. SM801) and then the slides were incubated with CD8 antibody (Histosure ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which was 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 70% 10 mM ammonium sulfate and 30% methanol ...
-
bioRxiv - Neuroscience 2024Quote: ... and counter stained for 5 minutes with automated hematoxylin (DAKO). Slides were then dehydrated through alcohol gradients and xylene before being coverslipped.
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases of first-step HPLC separation were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The column (C18, 5 µm, 250 × 4.6 mm, Agilent, USA) was eluted at 30 °C using acetonitrile/water (4/6 ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 30min and imaged on the Cytation 5 (Agilent Technologies) using DAPI and RFP filters/LED cubes ...