Labshake search
Citations for Agilent :
151 - 200 of 3268 citations for 3 Cyclohex 1 enyl acrylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... The Long-Chain Fatty Acid Substrate Oxidation kit (Agilent cat #103672-100) was utilized to probe differences in OCR upon injection with either vehicle (media only ...
-
bioRxiv - Cancer Biology 2022Quote: ... The matrix employed was α-cyanohydroxycinnamic acid obtained in solution from Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... Resin acid identification and quantification were performed by capillary GC (Agilent 7890A). Helium ...
-
bioRxiv - Microbiology 2023Quote: ... Amino acid analysis was performed by high-pressure liquid chromatography (HPLC) (Agilent 1100 ...
-
bioRxiv - Biophysics 2022Quote: ... Amino acid analysis was performed on an Agilent 1260 HPLC (Agilent Technologies) equipped with a fluorescence detector using automated o-phtalaldehyde/2-mercaptopropionic acid (OPA/MPA ...
-
bioRxiv - Microbiology 2024Quote: ... Fatty acids were identified with a mass spectrometer (Agilent 5977B GC/MSD) according to the comparison of retention times of commercial fatty acid standards (Supelco 37) ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA was labeled with Hoechst (1:2000) for 3 min and the sections were mounted using fluorescence mounting media (Dako, S3023). All images were taken using a Zeiss Observer Z1 fluorescent microscope using a 10X objective ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were washed with Bond Wash buffer 3 x 30s and then incubated with either mouse anti-CD68 (M0814, 1:100, Dako, Carpenteria, CA), mouse anti-βIII-Tubulin (G7121 ...
-
bioRxiv - Immunology 2024Quote: ... The antigens on the slides were retrieved by submerging slides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent, Cat# S2375) and incubating at 97 °C for 40 min in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2024Quote: ... 12 by PCR using primers 3 and 4 listed in Supplementary Table 1 and cloned into the BamHI-KpnI site of pBluescript II KS (+) (Stratagene, CA, USA) using ligation mix (Takara Bio USA) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the concentration of various organic acids were measured by HPLC (Agilent, 1260 Infinity), using a standard analytical system (Shimadzu ...
-
bioRxiv - Plant Biology 2022Quote: ... whereas the amino acids were quantified using an HPLC system (Agilent 1100; Agilent) equipped with a Zorbax Eclipse Plus C18 column (4.6 mm × 150 mm ...
-
bioRxiv - Physiology 2022Quote: Free fatty acid composition was evaluated by GC-MS (Agilent technology GC7890-MS5975). Briefly ...
-
bioRxiv - Plant Biology 2022Quote: ... whereas the amino acids were quantified using an HPLC system (Agilent 1100; Agilent) equipped with a Zorbax Eclipse Plus C18 column (4.6 mm × 150 mm ...
-
bioRxiv - Cell Biology 2020Quote: ... fatty acid oxidation was assessed by using the Seahorse XF24 Analyzer (Agilent Technologies) to measure mitochondrial respiration ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the fatty acids were dosed from the autosampler of a GC (Agilent 7890A) as pulses to the front inlet packed with the catalyst bed (maintained in the range 250-400 °C) ...
-
bioRxiv - Microbiology 2020Quote: ... Amino acid analysis was performed by HPLC (Agilent 1100; Agilent Technologies, Massy, France) with a guard cartridge and a reverse phase C18 column (Zorbax Eclipse-AAA 3.5 μm ...
-
bioRxiv - Molecular Biology 2021Quote: ... Library quality was confirmed using the Agilent 2200 TapeStation Nucleic Acids System (Agilent).
-
bioRxiv - Molecular Biology 2022Quote: ... and 2.5 µM medronic acid (5191-4506, Agilent Technologies, Santa Clara, CA, USA). The LC gradient was ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The quality of nucleic acids was assessed with a Fragment Analyzer (Agilent, Switzerland) at the Lausanne Genomic Technologies Facility of the University of Lausanne.
-
bioRxiv - Biochemistry 2022Quote: ... All libraries at this step yielded >300,000 colonies implying a 100x coverage (assuming 1/3 of the variants were perfect based on our previous analysis of Agilent OLS based libraries). Each sublibrary was combined at an equimolar ratio to make a complete library with all intended mutations included.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Primary antibodies were diluted 1:4000 for anti-sGCα1 and 1:2000 for anti-sGCβ1 antibody in 3% dry milk in TBST and incubated with nitrocellulose membranes at 4°C over-night following challenge of membranes with secondary goat anti-rabbit antibody (1:2000 in 3% milk in TBST) conjugated to horseradish peroxidase (Dako A/S, Denmark). Immuno-complexes were visualized using an enhanced chemiluminescence kit (Amersham Pharmacia Biotech ...
-
bioRxiv - Biochemistry 2022Quote: 50 μL of pure CrRPE1 concentrated at 9.5 mg mL−1 were injected on BioSEC-3 300 size-exclusion chromatography column (Agilent Technologies, Santa Clara, USA) equilibrated in buffer 20 mM Tris-HCl (pH 7.9 ...
-
bioRxiv - Immunology 2024Quote: ... The antigens on the slides were retrieved by submerging slides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent, Cat# S2375) and incubating at 97 °C for 40 min in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...
-
bioRxiv - Microbiology 2021Quote: Organic acids and ethanol were measured by high-performance liquid chromatography (Agilent, 1260 Infinity), using a standard analytical system (Shimadzu ...
-
bioRxiv - Bioengineering 2020Quote: ... butyric acid and glucose were measured using a high-performance liquid chromatography (HPLC, Agilent Technologies 1260 Infinity series ...
-
bioRxiv - Genetics 2020Quote: ... and L191H amino acid changes (Integrated DNA Technologies) and QuickChange II SDM Kit (Agilent). The pcDNA3-Myc-Exosc5 (pAC3519 ...
-
bioRxiv - Genetics 2020Quote: ... and L206H amino acid changes (Integrated DNA Technologies) and QuickChange II SDM Kit (Agilent). All plasmids were sequenced to ensure the presence of desired mutations and absence of any other mutations.