Labshake search
Citations for Agilent :
151 - 200 of 2120 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... were kept in a 5°C autosampler prior to analysis and injected onto a reverse- phase Zorbax SB-C18 column (150×3 mm, 5 μm particle size, Agilent, Santa Clara ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... were incubated with the indicated primary antibodies (Reagents) overnight at 4 °C followed by Envision/diaminobenzidine detection (Dako, Glostrup, Denmark) and hematoxylin counterstaining/mounting (Entellan ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were transferred to a nitrocellulose membrane before probing using a primary anti IL-36γ antibody (Biotechne (R&D) UK) overnight at 4°C and a secondary goat antibody (Dako) for 1 hour at room temperature to visualise any protein cleavage.
-
bioRxiv - Biochemistry 2020Quote: The supernatants of the quenched in vitro OMT reactions and fermentation samples were analyzed by reversed-phase HPLC (instrument: Agilent 1100; autosampler: HiP sampler G1367A, T=4°C, 10 μL injection; column: Agilent Zorbax Eclipse XDB-C18 80Å ...
-
bioRxiv - Immunology 2022Quote: ... The following antibodies were incubated in 0.1% Triton with 2% goat serum in PBS at 4°C overnight: rabbit anti-GFAP (1: 1000, DAKO, Z0334), rabbit anti-IBA-1 (1 ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein immunodetection was performed with primary abs diluted in blocking solution during overnight incubation at 4°C: rabbit polyclonal ab against alpha-1-antitrypsin (A0012, Dako, Agilent) at a 1:500 dilution ...
-
bioRxiv - Physiology 2022Quote: ... for 1 h at RT and incubated overnight at 4°C with 1:100 dilution of mouse anti-Ki67 antibody (Novocastra, Concord, ON, Canada) in antibody diluent (DAKO). Next ...
-
bioRxiv - Cancer Biology 2020Quote: ... and then with the primary (Supplementary Table 2) (overnight 4°C) and the secondary (HRP-conjugated anti-mouse or -rabbit, DAKO) (2h ...
-
bioRxiv - Bioengineering 2022Quote: ... and incubated overnight at 4 °C with primary antibodies for the glial fibrillary acidic protein (GFAP; 1:1000, Z0334, Dako), ionised calcium-binding adapter molecule 1 (IBA1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibody incubation was performed overnight at 4 °C with rabbit monoclonal anti-PSyn EP1536Y diluted 1:320,000 in DAKO antibody diluent (Agilent #S0809). After three 5-min washes with PBST ...
-
bioRxiv - Cell Biology 2024Quote: hAC were fixed with 4% formalin and blocked for 1 h at 37°C (Protein-Block serum free, X0909 Dako Agilent). COL2 antibody (MA5-13026 ...
-
bioRxiv - Cell Biology 2022Quote: ... Plates were immediately centrifuged at 2 000 x g for 20 min at 4 °C and left on ice until insertion into the Seahorse XFe96 Analyzer (Agilent) after the cartridge plate calibration cycle on the analyzer was complete ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight at 4°C in primary antibodies (RFP from Chromotek 5f8-100 at 1:200, GFAP from Agilent DAKO Z033429-2 at 1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight at 4°C in primary antibodies (RFP from Chromotek 5f8-100 at 1:200, GFAP from Agilent DAKO Z033429-2 at 1:500 ...
-
bioRxiv - Microbiology 2023Quote: Pooled gradient fractions were diluted 1:2 with ice-cold PBS and tumbled overnight at 4°C with 50 µl Strataclean resin (Agilent). Beads were pelleted at 600 RCF for 5 min at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... Shimadzu LC-10AT; autosampler: HiP sampler G1367A, T = 4°C, 10 µL injection; flow rate: 1 mL/min; column: Agilent Zorbax Eclipse XDB-C18 80Å ...
-
bioRxiv - Neuroscience 2023Quote: ... and kept at 4°C overnight with primary antibodies (chicken anti-GFP, Aves Labs, 1:4000; rabbit anti-GFAP, Agilent Pathology Solutions ...
-
bioRxiv - Genetics 2023Quote: ... Membranes were labelled with primary antibody for 1 hour at room temperature or overnight at 4°C followed by incubation with HRP-conjugated secondary antibodies (Dako). Membranes were developed using the Western Lightning ECL system (Perkin Elmer) ...
-
bioRxiv - Physiology 2024Quote: ... sections were washed three times with cold 0.1% Triton in PBS and then incubated with primary antibodies at 4 °C overnight after being blocked with protein blocking solution (DAKO) for 5-10 min at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 mL capacity (Agilent Cat. #: 5185-5991) and centrifuged at 17,172 × g for 45 min at 4 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... (4) CD68 (Macrophages, 1:400, M0876; Dako)–Opal 620 ...
-
The integrated stress response promotes macrophage inflammation and migration in autoimmune diabetesbioRxiv - Immunology 2024Quote: ... and anti-insulin (Dako; IR002; 1:4) antibodies ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... (3) CD8 (Cytotoxic T Cells, 1:400, M7103; Dako)–Opal 570 ...
-
bioRxiv - Neuroscience 2021Quote: ... Slides were then incubated overnight at 4°C with primary polyclonal anti-GFAP rabbit antibody (1:1000; Z0334, DAKO, Golstrup, Denmark) or anti-collagen IV rabbit antibody (1:200 ...
-
bioRxiv - Molecular Biology 2021Quote: ... dilution 1:100)] in TNB blocking buffer for overnight at 4°C followed by one-hour incubation with secondary antibodies: EnVisionTM+ System-HRP (DAKO K4002). TRITC-based Tyramide reagent pack from Perkin Elmer was used to amplify the fluorescence of Ki67 and c-Kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... The sections were incubated with a primary antibody at 4°C overnight and with a rabbit/mouse HRP-conjugated secondary antibody (Dako, Denmark) at room temperature for 2 h ...
-
bioRxiv - Microbiology 2020Quote: ... for 2hrs at 40°C and then incubated over-night at 4°C on a rotating wheel with 2 μg of anti HBc antibody (Dako B0586). Immune-complexes were captured with protein A/G magnetic beads ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were then incubated overnight at +4 °C with primary antibodies diluted in the same solution or in an antibody diluent (Agilent #S3022). The samples were then washed in 0.1 % Triton X-100 or 1.0 % Tween20 in PBS for 30-60 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein immunodetection was performed with primary abs diluted in blocking solution during overnight incubation at 4°C: rabbit polyclonal ab against alpha-1-antitrypsin (A0012, Dako, Agilent) at a 1:500 dilution ...
-
bioRxiv - Genetics 2022Quote: ... and incubated in the dark overnight at 4 C before running on a Novocyte Quanteon flow cytometer using NovoExpress 1.3.0 software (Agilent, Santa Clara, CA) at a flow rate of 14 uL/minute ...
-
bioRxiv - Pathology 2020Quote: ... Primary antibodies were incubated overnight at 4°C and appropriate HRP-conjugated secondary antibodies (DAKO, Agilent Technologies, Santa Clara, CA, USA) for 1 hour at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... at 4°C overnight followed by incubation with Dako EnVision+System-HRP Labelled Polymer Anti-Mouse (Aglient Dako, Cat # K400111-2) for 60 min at room temperature ...
-
bioRxiv - Zoology 2020Quote: ... hydrated through graded ethanol and incubated overnight at 4°C with a mouse anti-human CD68 clone KP1 monoclonal antibody (1:100, Dako, Denmark). Then ...
-
bioRxiv - Immunology 2024Quote: A total of 10 µg/ml rHA were coated on an ELISA plate at 4 °C ON and afterwards incubated with rabbit anti-HA antibody (1:2000 dilution) (Dako, A0001) 2h at RT ...
-
bioRxiv - Cell Biology 2024Quote: hAC were fixed with 4% formalin and blocked for 1 h at 37°C (Protein-Block serum free, X0909 Dako Agilent). COL2 antibody (MA5-13026 ...
-
bioRxiv - Neuroscience 2023Quote: ... for 60 min and incubated overnight at 4°C with primary antibodies diluted in DAKO Antibody Diluent (Agilent, cat. #S080983-2). Sections were washed in PBS (3 x 5 min ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were incubated in primary antibodies overnight at 4 °C (Figure S2) and in secondary antibody-horseradish peroxidase complex (REAL EnVision detection kit, Dako #K5007) for 1 h at RT ...