Labshake search
Citations for Agilent :
1 - 50 of 2120 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Microbiology 2022Quote: ... 30 sec at 60°C (steps 3 and 4 were repeated 40 times) was done with the AriaMX real-time PCR System (Agilent).
-
bioRxiv - Microbiology 2024Quote: ... Amplicons (each 3-4 kbs in length) were generated via PCR using EasyA polymerase (Agilent) and Sanger sequenced.
-
bioRxiv - Physiology 2020Quote: ... blocked with 3% BSA in PBS1 and incubated overnight at 4°C with primary polyclonal antibodies for glucagon and insulin (Dako, Agilent, Santa Clara, CA, USA) (Table S8) ...
-
bioRxiv - Cancer Biology 2024Quote: ... the AFC (7-amino-4-trifluoromethyl coumarin) fluorescent signals were measured on a Cytation 5 instrument (Agilent Technologies) using the fluorometer function (410-20nm excitation bandwidth ...
-
bioRxiv - Microbiology 2024Quote: ... samples were cleared for 7 min at 14,000 × g at 4 °C and transferred to LC-MS polypropylene conical vials (Agilent). Vials were stored at −80 °C until analysis using LC-MS.
-
bioRxiv - Physiology 2020Quote: ... blocked with 3% BSA in PBS1 and incubated overnight at 4°C with primary polyclonal antibodies for glucagon and insulin (Dako, Agilent, Santa Clara, CA, USA) (Table S8) ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The labeled complementary RNAs were hybridized onto a whole human genome oligo microarray (4 3 44K; Agilent Technologies). After washing the slides ...
-
bioRxiv - Molecular Biology 2020Quote: ... were induced with 2μg/mL doxycycline for 6 hours prior to crosslinking at 100mJ/cm2 at 4°C in a Stratalinker 1800 (Stratagene). Cells were then processed according to the eCLIP protocol for input and immunoprecipitated samples until cDNA was obtained ...
-
bioRxiv - Biochemistry 2021Quote: ... at 4°C overnight diluted in antibody diluent (Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cancer Biology 2022Quote: ... cytokeratin (DAKO, Cat. M3515; 1:100 at 4 °C), ki67 (ThermoFisher ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 6 minutes (30 seconds ON, 30 seconds OFF) at 4°C to obtain ~200 bp fragments (confirmed using an Agilent Bioanalyzer). Sonicated DNA was extracted using ethanol precipitation ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Cell Biology 2021Quote: ... overnight at 4°C after blocking with blocking solution (S3022, Dako) for 30 min ...
-
bioRxiv - Genetics 2020Quote: ... at 4°C followed by secondary antibody (Dako Cytomation, Glostrup, Denmark) for 30 min at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... overnight at 4°C in Dako REAL antibody diluent (Dako, S2022). To visualized the specific signal ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step ...
-
bioRxiv - Physiology 2024Quote: ... tissues were incubated with primary antibody over night at 4°C (guinea pig anti-insulin at 1:4, diluted in 1% goat serum/PBS, Agilent). This was followed by 1-hour incubation with fluorophore-conjugated secondary antibodies (Cy3-anti-guinea pig ...
-
bioRxiv - Cancer Biology 2024Quote: ... the sections were incubated with primary antibody (PRDX2, TFRC or 4-HNE) at 4°C overnight and followed by incubation with secondary antibody FLEX/HRP (Dako) at room temperature for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were digested by DpnI enzyme for 2h at 37°C (Agilent) and loaded on a 1% Agarose Gel ...
-
bioRxiv - Bioengineering 2024Quote: ... 12 by PCR using primers 3 and 4 listed in Supplementary Table 1 and cloned into the BamHI-KpnI site of pBluescript II KS (+) (Stratagene, CA, USA) using ligation mix (Takara Bio USA) ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 4°C overnight diluted 1:200 in antibody diluent (#S3022, Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sections were incubated at 4°C with anti-VWF (1:200, Dako) and anti-α-smooth muscle actin (1:100 ...
-
bioRxiv - Physiology 2023Quote: ... at 4 °C overnight and mounted with fluorescence mounting medium (Agilent, USA).
-
bioRxiv - Biochemistry 2024Quote: ... overnight at 4 °C) and blocking of endogenous peroxidase (peroxidase block; Dako) for 10 min at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... blocked using 10% Normal Goat Serum (NGS) and incubated overnight with the following primary antibodies in 5% NGS overnight at 4°C: rabbit anti-GFAP (DAKO; #Z0334;1:1000), rat anti-L1-CAM (Millipore ...
-
bioRxiv - Bioengineering 2022Quote: ... Cell nuclei were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI) for 5 min before being mounted using DAKO mounting medium (Agilent, catalog no. S302380–2). Imaging of the histological samples was performed on the Microscope Axio Imager.A2 (Carl Zeiss Microscopy ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen-antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with hematoxylin (Dako ...
-
bioRxiv - Physiology 2022Quote: ... Antigen–antibody complexes were revealed with 3-3′- diaminobenzidine (K346811, Dako) or the DAB (Polymer ...
-
bioRxiv - Cell Biology 2024Quote: ... at 1:500 and 3-3’-diamino-benzidine-tetrahydrochloride (Dako, K3468). Stained sections were imaged using an NanoZoomer 2.0HT (Hamamatsu).
-
bioRxiv - Cancer Biology 2024Quote: ... Antigen–antibody complexes were reveled with 3-3′-diaminobenzidine (K346811, Agilent). Sections were counterstained with hematoxylin (CS700 ...
-
bioRxiv - Immunology 2023Quote: ... The tissue was then incubated overnight at 4°C with anti-CD4 (Dako) in a 1:10 dilution ...
-
bioRxiv - Cancer Biology 2022Quote: ... Slides were next incubated overnight at 4°C with anti-PCNA antibody (DakoCytomation, clone PC10 ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 125°C for 4 min in pH 6.0 Target Retrieval Solution (Agilent Technologies Inc. ...