Labshake search
Citations for Agilent :
1901 - 1950 of 5718 citations for Rat Cystatin S CST4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... The mixed library was then quantified using a BioAnalyzer High Sensitivity DNA kit (Agilent).
-
bioRxiv - Genomics 2019Quote: KLF4 R462A mutation has been generated using the site-directed mutagenesis kit from Agilent #210518 ...
-
bioRxiv - Immunology 2019Quote: ... Quality of the individual libraries was assessed using the High Sensitivity DNA Kit (Agilent). Individual libraries were quantitated via qPCR using the KAPA Library Quantification Kit ...
-
bioRxiv - Cancer Biology 2019Quote: ... and the integrity was checked by using the Agilent RNA 6000 Nano Kit (Agilent).
-
bioRxiv - Molecular Biology 2019Quote: ... Catalytic mutants were generated by site directed mutagenesis (Agilent Quik Change II Mutagenesis Kit). Primers used ...
-
The antibiotic bedaquiline activates host macrophage innate immune resistance to bacterial infectionbioRxiv - Immunology 2019Quote: Measurement of glycolysis was done using the Glycolytic rate assay kit (Seahorse, Agilent Technologies), following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... and L191H amino acid changes (Integrated DNA Technologies) and QuickChange II SDM Kit (Agilent). The pcDNA3-Myc-Exosc5 (pAC3519 ...
-
bioRxiv - Genetics 2020Quote: ... and L206H amino acid changes (Integrated DNA Technologies) and QuickChange II SDM Kit (Agilent). All plasmids were sequenced to ensure the presence of desired mutations and absence of any other mutations.
-
bioRxiv - Cell Biology 2019Quote: ... and IRE1β(G641H) mutations were introduced using QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent). All constructs were confirmed by restriction digest and sequencing (Harvard Biopolymer Facility).
-
bioRxiv - Genomics 2020Quote: ... RNA underwent quality control testing using a 2100 Bioanalyzer (RNA 6000 Pico kit, Agilent) followed by cDNA library preparation using the KAPA Stranded mRNA-Seq kit (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quality of RNA was assessed using the 2100 Bioanalyzer RNA 6000 Pico kit (Agilent). RNA samples were depleted of rRNA with the NEBNext rRNA Depletion kit (NEB ...
-
bioRxiv - Biochemistry 2019Quote: AmtB mutants were generated using the Quikchange XL site-directed mutagenesis kit (Agilent Technologies), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA was isolated using the Absolutely RNA miniprep kit (Agilent, Santa Clara, CA). Cells were homogenized in 200μL of lysis buffer ...
-
bioRxiv - Synthetic Biology 2020Quote: ... during hybridisation assembly using the Agilent Microarray Hybridisation Chamber Kit (Agilent, Cat No. G2534A) and following the standard protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... and RNA quality was assessed using the Agilent Bioanalyzer 2100 Nano kit (Agilent, USA) (RNA integrity number RIN ...
-
bioRxiv - Molecular Biology 2020Quote: Mutations in Vκ1 SP were performed using QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent) with the respective primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA integrity was measured with the RNA 600 pico Kit on a Bioanalyser (Agilent), 10 ng RNA with a RIN>6 was used for library preparation with the NuGen Ovation FFPE library system kit and mouse lnDA-C primers ...
-
bioRxiv - Pathology 2021Quote: ... Clone libraries were created using Strategene’s cloning kit (Agilent Technologies, Santa Clara, CA, USA) as per manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Integrity and concentration of RNA was checked using Bioanalyzer 2100 RNA Nano kit (Agilent), following standard protocols ...
-
bioRxiv - Microbiology 2020Quote: ... All point mutations were made using Site Directed Mutagenesis QuikChange II Kit (Agilent; 200524).
-
bioRxiv - Molecular Biology 2020Quote: ... The purified final library was validated with a TapeStation D1000 kit (Agilent, 5067-5582). The libraries were sequenced at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Genomics 2021Quote: ... and library size was determined via Bioanalyzer (Agilent High Sensitivity DNA Kit, 5067-4626). Reactions were sequenced on an Illumina NextSeq 500 using the 300-cycle High Output v2 Kit or NovaSeq 6000 using the SP 300-cycle v1 kit.
-
bioRxiv - Pathology 2019Quote: ... and then for an additional 30 minutes with the alkaline phosphatase EnVision kit (DakoCytomation). The second reaction was detected by means of a Vector blue alkaline phosphatase substrate kit (Vector Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... and for fragment size distribution using the BioAnalyzer 2100 High Sensitivity DNA Kit (Agilent). The fragment size distribution is used to determine how to make the cDNA into a sequencing library ...
-
bioRxiv - Immunology 2021Quote: ... and DNA fragment size was assessed using the High Sensitivity DNA BioAnalyzer kit (Agilent). cDNA concentrations were normalised and 0.125 ng of each cDNA was used in a quarter volume of a Nextera XT DNA library preparation kit (Illumina) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The quality of the total RNA was assessed using the RNA Nano Kit (Agilent). Poly-A selection was conducted on the total RNA using the PrepX PolyA mRNA Isolation Kit (Takara) ...
-
bioRxiv - Cancer Biology 2019Quote: ... All point mutants were generated by using the QuickChange site-directed mutagenesis kit (Stratagene),
-
bioRxiv - Immunology 2019Quote: ... Point mutations were generated using the QuickChange II site-directed mutagenesis kit (Agilent, 200523) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... The intact cellular oxygen consumption rate (OCR) assay kit was purchased from Seahorse Bioscience. Horseradish peroxidase (HRP)-conjugated ...
-
bioRxiv - Microbiology 2019Quote: ... Cloning of pCAGGS-VP3026A29S was performed with the multi-site directed mutagenesis kit (Agilent) according to the manufacture’s recommendations ...
-
bioRxiv - Plant Biology 2019Quote: ... and quality was assessed with the Agilent 6000 Nano Kit (Agilent, Santa Clara, California). Strand-specific library construction and paired-end RNA sequencing were done by Novogene (Chula Vista ...
-
bioRxiv - Genetics 2021Quote: ... Mutations were made in the CREAX reporter using the Quickchange II Kit (Stratagene, 200518). Details of the mutations are shown in supplementary table 1 ...
-
bioRxiv - Cell Biology 2019Quote: ... The VPS41 mutant variants were made using the QuickChange Site-Directed Mutagenesis kit (Agilent) using the primers 5’-CAGCTTGTTGTACTTCCGTATGTAAAGGAGA and 5’- TCTCCTTTACATACGGAAGTACAACAAGCTG to generate GFP-VPS41S285P and 5’- GTTTATCTTCTGAGCTGAATGGGTTAATAGCC and 5’-GGCTATTACCCATTCAGCTCAGAAGATAAAC to generate GFP-VPS41R662* ...
-
bioRxiv - Biochemistry 2020Quote: Mutants of StSOR were constructed with a QuikChange site-directed mutagenesis kit (Agilent Technologies) using the following and complementary oligonucleotides ...
-
bioRxiv - Biochemistry 2021Quote: ... This was corrected by site-directed mutagenesis (SDM) using the QuikChange Lightening kit (Agilent), following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... Point mutations were created using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and pBRA TseV2 and pBRA TseV3 plasmids as templates ...
-
bioRxiv - Cell Biology 2020Quote: ... and fragmented cDNA integrity was confirmed using the Agilent RNA 6000 Nano Kit (Agilent) and 2100 Bioanalyzer (Agilent) ...
-
bioRxiv - Neuroscience 2021Quote: ... Ric S73N and Q117L mutants were generated using the QuikChange II mutagenesis kit (Stratagene). YFP- and CFP-dDAT and Ric constructs were generated by subcloning into pEYFP-C1 and pECFP-C1 vectors ...
-
bioRxiv - Synthetic Biology 2022Quote: ... We used the Fragment Analyzer dsDNA 920 Reagent Kit (Agilent Technologies, Santa Clara, CA) to perform the automated gel electrophoresis analysis ...
-
bioRxiv - Biophysics 2019Quote: ... Point mutation A577I was introduced using QuikChange Lightning Site- Directed Mutagenesis Kit (Agilent Technologies). The constructs were cloned into a pET28b vector (Novagen ...
-
bioRxiv - Biophysics 2021Quote: ... Mutations were introduced into bovine rhodopsin using the QuikChange site-directed mutagenesis kit (Agilent) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2020Quote: ... Point (Site) mutations of SOD2 were generated by QuikChange Site-Directed Mutagenesis kit (Stratagene). Both WT SOD2 and SOD2 mutant plasmids were transfected into ZF4 cells using Lipofectamine 3000 Transfection Reagent (Invitrogen).
-
bioRxiv - Biochemistry 2021Quote: ... or 229 (A229C) using QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). The mutated constructs were purified as described above ...
-
bioRxiv - Genomics 2021Quote: ... RNA integrity and quantity were finally measured using RNA Nano 6000 Assay Kit (Agilent) of the Bioanalyzer 2100 system ...
-
bioRxiv - Cancer Biology 2021Quote: ... The PEAK3 A436E mutant was generated with the QuickChange Site-Directed Mutagenesis Kit (Stratagene). The pCDNA3.1-V5-PTK2B (PYK2 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA samples were tested using an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit). Samples with an RNA Integrity Number (RIN ...
-
bioRxiv - Microbiology 2020Quote: ... Point mutations were created using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and pBRA SP-Tae5STM (STM14_0336 ...
-
bioRxiv - Microbiology 2019Quote: ... and TEXEL point mutations were accomplished similarly with Quikchange site-directed mutagenesis kit (Agilent).
-
bioRxiv - Microbiology 2021Quote: ... Agilent Bioanalyzer with Agilent RNA 6000 Nano Kit (Agilent Technologies, Palo Alto, CA, USA) was used as per manufacturer’s guidelines to assess the integrity of RNA samples ...
-
bioRxiv - Immunology 2020Quote: ... and RNA integrity was evaluated with the Bioanalyzer RNA pico kit TapeStation (Agilent Technologies). Two hundred nanograms of total RNA was subsequently processed to generate RNA-seq libraries using NEBNext Poly(A ...