Labshake search
Citations for Agilent :
1751 - 1800 of 5718 citations for Rat Cystatin S CST4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... and final sequencing libraries were performed using Bioanalyzer High Sensitivity DNA Kit (Agilent). The sequencing libraries for scRNAseq and scTCRseq were normalized to 4nM concentration and pooled using a volume ratio of 4:1 ...
-
bioRxiv - Genomics 2023Quote: ... and assessed for fragment size using the BioAnalyzer HS DNA Assay kit (Agilent). Following library pooling in equimolar concentrations ...
-
bioRxiv - Genomics 2023Quote: ... Individual library Qc was performed using the BioAnalyzer HS DNA Assay kit (Agilent).
-
bioRxiv - Cell Biology 2023Quote: ... Mitochondrial respiration was measured using Seahorse XF Cell Mito Stress Test kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Using the DNA high-sensitivity kit in the 2100 Bioanalyzer (Agilent Technologies, USA), the library quality and quantity of the appropriate fragment length (250 bp ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from NSC34 cells using the Absolutely RNA Microprep kit (Agilent). The rRNA levels were measured by real-time quantitative PCR after reverse transcription of RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... and verified using the Bioanalyzer DNA High Sensitivity Assay Kit (Agilent, 5067-4626). Validated samples were sequenced using the NextSeq1000/2000 P2 Reagents (100 Cycles ...
-
bioRxiv - Plant Biology 2023Quote: ... and size distribution was measured using the Agilent High Sensitivity DNA Kit (Agilent). Libraries were pooled together and performed paired-end sequencing on an Illumina Hi-Seq 2000.
-
bioRxiv - Neuroscience 2023Quote: ... Mutagenesis was performed using the QuikChange II Site-directed Mutagenesis kit (Agilent Technologies).
-
bioRxiv - Cancer Biology 2023Quote: ... RNA integrity was analyzed using NanoChip (Agilent RNA 6000 Nano kit, 5067-1511). A total of 2 µg RNA was purified by poly(A ...
-
bioRxiv - Physiology 2023Quote: ... A high sensitivity small DNA Fragment Analysis kit (Agilent Technologies, DNF-477-0500) was used to assess the quality of each library pool.
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were constructed using the Sure Select All Exon v6 library kit (Agilent) following the XT library preparation workflow ...
-
bioRxiv - Plant Biology 2023Quote: ... and size distribution was determined using the Agilent High Sensitivity DNA Kit (Agilent). Libraries were pooled together for paired-end sequencing on an Illumina Hi-Seq 3000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Purified libraries were run on Agilent High Sensitivity DNA Kit chip (Agilent Technologies) to verify the expected size distribution ...
-
bioRxiv - Neuroscience 2023Quote: ... Library quality was assessed by high sensitivity DNA analysis kit (Agilent, 5067-4626) on the 2100 Bioanalyzer instrument ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA integrity was validated using the Agilent 6000 Pico Kit (Agilent, #5067-1513). For each sample ...
-
bioRxiv - Genetics 2023Quote: Genotyping was performed using the Herculase II Fusion DNA Polymerases kit (Agilent, #600677) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Site-directed mutagenesis was performed by QuikChange Site-directed Mutagenesis Kit (Agilent 200523). Multi site-directed mutagenesis was performed by QuikChange Multi site-directed Mutagenesis Kit (Agilent 200513) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mutagenesis was performed using the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent) following manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2023Quote: ... and integrity using Bioanalyzer 2100 and RNA Nano 6000 Kit (Agilent Technologies, USA). Sequencing libraries were generated using NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... Retrovirus production was performed according to the MBS Mammalian Transfection Kit (Agilent Technologies) and virus was harvested after 2 days from confluent cells ...
-
bioRxiv - Cell Biology 2023Quote: ... Whole exome sequencing (WES) was performed using the Mouse All Exon kit (Agilent) for target capture followed by next-generation sequencing by Psomagen ...
-
bioRxiv - Molecular Biology 2023Quote: The Seahorse XF Cell Mito Stress Test Kit (Cat. No. 103015-100, Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A Plant RNA Pico kit was used on a 2100 Bioanalyzer (Agilent Technologies) to confirm the quality of the RNA isolates ...
-
bioRxiv - Genomics 2024Quote: ... and Fragment Analyser using the DNA HS 50kb large fragment kit (Agilent Tech.) Before PacBio HiFi library preparation ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the HS-D5000 and HS-D1000 High Sensitivity DNA kits (Agilent Technologies), respectively ...
-
bioRxiv - Biophysics 2024Quote: ... site-directed mutagenesis was performed using Quick Change II XL kit (Agilent Technologies) using the primers listed in Table S3 ...
-
bioRxiv - Plant Biology 2024Quote: ... or Femto Pulse Genomic DNA 165 kb Kit (Agilent cat# FP-1002-0275). For samples sourced from “OCBD” (Supplemental Table 1 ...
-
bioRxiv - Neuroscience 2024Quote: ... and integrity (Agilent RNA 6000 Pico kit; Agilent Technologies, Santa Clara, CA, USA). The average RNA integrity number (RIN ...
-
bioRxiv - Biophysics 2024Quote: Protein variants were constructed using a QuikChange site-directed mutagenesis kit (Agilent, USA). The primer that introduced desired nucleotide changes was designed using QuikChange online tool (Table S3C ...
-
bioRxiv - Genomics 2024Quote: ... DNA quality was assessed with the TapeStation genomic DNA kit (Agilent, #5067-5365). Samples too diluted to be compatible with the kit were first concentrated using AMPure Beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2024Quote: ... and H1N1pdm09 were generated using the QuikChange II site-directed mutagenesis kit (Agilent). The PR8 pHW-PA(ΔX ...
-
bioRxiv - Molecular Biology 2024Quote: Isolated RNA was examined on a Bioanalyzer with the RNA Nano kit (Agilent). RNA-Seq library preparation was carried out with 1 µg of RNA from all samples that passed an RNA Integrity Number (RIN ...
-
bioRxiv - Biochemistry 2024Quote: ... mutagenesis was performed using the QuickChange® Lightning Site-Directed Mutagenesis Kit (Agilent) using the forward primer 5’ CAAACAGATTGTGAGTATAACTACTGGGGCCAG 3’ and the reverse primer 5’ AGTTATACTCACAATCTGTTTGTGGACTCCAACCCG 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthetized using the Affinity Script Multiple Temperature cDNA Synthesis kit (Agilent), following manufacturer’s instructions with oligo-dT primers ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 7 using the Agilent SureSelect Kit (Agilent Technologies, Santa Clara, CA, USA). Whole-genome sequencing was carried out for the proband of Pedigree 5 using the DNBSEQ-T7 platform (Huada ...
-
bioRxiv - Cell Biology 2024Quote: JOSD1 C36A mutant was generated using QuickChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara ...
-
bioRxiv - Genetics 2024Quote: ... cDNA was synthesized with AffinityScript QPCR cDNA Synthesis Kit (Agilent, catalog number 600559). All procedures were performed following the manufacturer’s protocols ...
-
bioRxiv - Genetics 2024Quote: Total RNA was isolated with Absolutely RNA Miniprep Kit (Agilent, catalog number 400800). cDNA was synthesized with AffinityScript QPCR cDNA Synthesis Kit (Agilent ...
-
bioRxiv - Developmental Biology 2024Quote: ... following the instructions of the manufacturer (Agilent RNA 6000 Pico Kit 5067–1513). Amplification of the extracted RNA (700 pg ...
-
bioRxiv - Neuroscience 2024Quote: ... and High Sensitivity NGS fragment analysis kit on the Fragment Analyzer (Agilent Technologies). The amount of cDNA was standardized across samples and the libraries were sequenced on Illumina NextSeq500 sequencing machine with 75-bp single-end reads ...
-
bioRxiv - Molecular Biology 2024Quote: Site-directed mutagenesis was performed using QuikChange II Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA was quantified on an Agilent BioAnalyzer via the Pico kit (Agilent). SMART-Seq HT Kit (Takara ...
-
bioRxiv - Cancer Biology 2021Quote: ... and cDNA was generated using AccuScript High Fidelity 1st Strand cDNA Synthesis Kit (Stratagene). The Mus musculus IGHV1-72*01 allele (IMGT accession number J00530:206-499) ...
-
bioRxiv - Bioengineering 2020Quote: ... RNA isolation and reverse transcription were performed using the Absolutely RNA Miniprep kit (Stratagene) and cDNA synthesis system (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibody was pretreated with a biotinylation reagent (Animal Research Kit, DAKO, Denmark) for 20 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... avidin-biotin blockade was performed using the avidin-biotin blocking kit (DAKO, Glostrup, Denmark). To eliminate nonspecific protein interactions with the primary antibody ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was amplified and labeled using the low RNA input linear amplification kit (Agilent). Labeled cDNA was hybridized onto Affymetrix Human Gene 2.0-ST array ...
-
bioRxiv - Developmental Biology 2020Quote: ... amplified RNAs were quality checked by using Agilent High Sensitivity D5000 kit (Agilent Technologies). RNA-seq libraries were constructed using Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: ... all DNA libraries were checked with Agilent BioAnalyzer High Sensitivity DNA Analysis Kit (Agilent). DNA concentration was measured both by Qubit dsDNA HS assay kit (Thermo Fisher Scientific ...