Labshake search
Citations for Agilent :
1701 - 1750 of 6604 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... High pH kit reagents (K800021-5, Dako). pSer202/Thr205-tau antibody (MN1020B ...
-
bioRxiv - Neuroscience 2024Quote: ... using SureSelect Target Enrichment kit (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... with the High Sensitivity DNA Kit (Agilent) according to manufacturer’s instructions and the 10X Genomics protocols ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the kit High Sensitivity D5000 (Agilent) and the average size of the libraries was 284.25 ...
-
bioRxiv - Microbiology 2020Quote: ... The quantity and size distribution of the RNA and DNA were determined by Agilent Bioanalyzer 2100 with an RNA 6000 Pico Kit and a DNA 1000 kit (Agilent Technologies, Santa Clara, CA, USA).
-
bioRxiv - Microbiology 2022Quote: ... Site-directed NS1 mutants were produced using a site-directed mutagenesis kit (QuikChange XL Site-Directed Mutagenesis Kit, Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... gene expression was measured using the following TaqMan® Gene Expression Assays on an Mx3005P QPCR System (Agilent, Santa Clara, CA, USA): HIF1α ...
-
bioRxiv - Plant Biology 2020Quote: ... Activities of photosynthetic enzymes were measured at 25°C using an NADH-coupled enzyme assay with the rate of NADH oxidation or reduction monitored at 340 nm using a diode array spectrophotometer (Agilent model 8453) as described by Sharwood et al ...
-
bioRxiv - Microbiology 2022Quote: ... The quality of RNA from each stage was analyzed using Agilent Bioanalyzer’s RNA 600 Nano assay class (Agilent Tech., Sta. Clara, CA) before pooling equal amounts to be used for cDNA synthesis ...
-
bioRxiv - Neuroscience 2020Quote: ... the sample quality was checked with both the Qubit 3 Fluorometer and the High Sensitivity D1000 ScreenTape assay (Agilent Technologies #5067-5584). The libraries were equimolarly pooled ...
-
bioRxiv - Genomics 2020Quote: ... The integrity of the extracted RNA was analyzed using the Agilent high sensitivity RNA screentape assay on Agilent 2200 TapeStation following the manufacturer’s guidelines (Agilent, Santa Clara, CA).
-
bioRxiv - Immunology 2020Quote: ... sterile XF assay buffer (Seahorse XF RPMI Medium supplemented with 10mM glucose, 2mM L-glutamine, and 1mM pyruvate, pH 7.4; Agilent Technologies, Waldbronn, Germany) was used for experiments ...
-
Neuron-astrocyte metabolic coupling facilitates spinal plasticity and maintenance of persistent painbioRxiv - Neuroscience 2022Quote: ... The bioanalyzer was calibrated and the assay was performed using Glycolytic Stress Test protocol as suggested by the manufacturer (Agilent Seahorse Bioscience,). The assay was run in one plate with 5-10 replicates per condition Seahorse Wave software was used to analyze metabolic data generated from both assays ...
-
Neuron-astrocyte metabolic coupling facilitates spinal plasticity and maintenance of persistent painbioRxiv - Neuroscience 2022Quote: ... The bioanalyzer was calibrated and the assay was performed using Mito Stress Test protocol as suggested by the manufacturer (Agilent Seahorse Bioscience,). The assay was run in one plate with 5-10 replicates per condition.
-
bioRxiv - Molecular Biology 2022Quote: All synthetic samples were quantitated using High Sensitivity (HS) DNA assays on an Agilent 2100 Bioanalyzer system (Agilent Technologies, Santa Clara, CA). To remain within the assay’s range of quantitation ...
-
bioRxiv - Immunology 2023Quote: ... Purified libraries were qualified on an Agilent Technologies 4150 TapeStation using a D1000 ScreenTape assay (Agilent, cat# 5067-5582 and 5067-5583). The molarity of adapter-modified molecules was defined by quantitative PCR using the Kapa Biosystems Kapa Library Quant Kit (Roche ...
-
bioRxiv - Immunology 2023Quote: ... following standard protocol and plated at a concentration of 2×105 cells per well of a seahorse XFe96 assay plate in seahorse XF DMEM media (Agilent; 103575-100) supplemented with 1mM pyruvate ...
-
bioRxiv - Developmental Biology 2023Quote: ... The libraries were quantified using the Qubit DNA HS assay and the library size was validated using DNA HS bioanalyzer chips (Agilent 5067-4626). The samples were pooled and subjected to paired-end sequencing on an Illumina NextSeq 500 platform with 2×75 bp read length.
-
bioRxiv - Neuroscience 2023Quote: ... RNA quality and concentration were assessed using the 2100 Bioanalyzer on an RNA 6000 Nano Assay (Agilent Technologies, Inc, all RINs > 9). Libraries were constructed by amplifying 500 ng of total RNA using 9 PCR cycles with the KAPA mRNA HyperPrep Kit (KAPA Biosystems) ...
-
bioRxiv - Pathology 2023Quote: ... Sample cDNA quality was checked using the Agilent High Sensitivity D5000 ScreenTape assay on the Agilent 4200 TapeStation System (Agilent Technologies, G2991BA). cDNA samples were then quantified and normalized prior to the library sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... laevis oocyte assays were measured using an Agilent 1290 Infinity II LC system coupled to the 6545 Q-TOF MS (Agilent Technologies, USA). The LC separation was conducted on a Poroshell 120 EC-C18 analytical column (Agilent ...
-
bioRxiv - Molecular Biology 2022Quote: ... at 37°C for 1 hour followed by vehicle or TGF-β (5 ng/ml) and 3000 cells were seeded into Seahorse assay microplates (Agilent Technologies). After 24h of incubation ...
-
bioRxiv - Molecular Biology 2022Quote: ... The quality and quantity of the library were assessed with the D1000 assay on the Tapestation (Agilent, 5067-5582 and 5067-5583) and the dsDNA HS assay from Qubit (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: ... An aliquot of each sample was taken for assessment with a 2100 Bioanalyzer using the RNA 6000 Pico assay (Agilent Technologies, USA) before the remainder of sample was snap frozen in liquid nitrogen and stored at -80C.
-
bioRxiv - Cell Biology 2024Quote: ... and RNA quality analyzed using Agilent 2100 Bioanalyzer RNA 6000 Nano Reagent using the Eukaryote Total RNA Nano Series II assay (Agilent Technologies Inc).
-
bioRxiv - Microbiology 2024Quote: RNA pools were assessed for quality using the Agilent 2100 Bioanalyzer with the Agilent RNA 6000 Nano Assay (Agilent Technologies, CA, USA). Library construction and sequencing was performed at the Australian Genomic Research Facility (Victoria ...
-
bioRxiv - Immunology 2024Quote: ... RNA integrity was assessed by Agilent High Sensitivity RNA ScreenTape Assay on an Agilent 4200 TapeStation following the manufacturer’s protocol (Agilent, Cat. No. 5067-5579, 5580 and 5581).
-
bioRxiv - Microbiology 2023Quote: ... DNA concentration of each PCR product was quantified using Qubit® 4.0 Green double-stranded DNA assay and assessed for quality with a bioanalyzer (Agilent 2100, USA). Libraries ...
-
bioRxiv - Biochemistry 2023Quote: ... The purity of the mRNA preparation was assessed using high-resolution automated electrophoresis in the Agilent 2100 Bioanalyzer system using the Bioanalyzer RNA 6000 pico assay (Agilent Technologies, Inc).
-
bioRxiv - Developmental Biology 2023Quote: ... and tested for RNA quality using the 2100 Bioanalyzer Agilent system with the Agilent RNA 6000 Nano assay (Agilent Technologies, 5067-1511). RNA spike-ins (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... a sample from each library was used to assess library fragment size distribution by electrophoresis using BioAnalyzer High Sensitivity DNA Assay (Agilent Technologies, CA) and to assess library concentration by qPCR using KAPA library quantification kit (KAPA Biosystems ...
-
bioRxiv - Genomics 2023Quote: ... Total RNA integrity was verified using RNA 6000 Pico Assay chips run on an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA). To deplete ribosomal RNA ...
-
bioRxiv - Systems Biology 2023Quote: ... cDNA was amplified by 7 cycles and the total yield of cDNA was assessed on High Sensitivity DNA Assay (Agilent 2100 Bioanalyzer) resulting on average in 168 ng ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The resulting libraries were quantified and quality checked using the Quanti-iT™ PicoGreen™ dsDNA assay and Bioanalyzer 2100 (Agilent technologies). The final indexed libraries were pooled together prior to sequencing on an Illumina Novaseq 6000 platform at the Swedish National Genomics Institute (NGI ...
-
bioRxiv - Bioengineering 2024Quote: ... The quality of the extracted RNA was assessed via automated electrophoresis using the RNA ScreenTape assay on an Agilent 2200 TapeStation system and analyzed with the TapeStation Analysis software (all Agilent Technologies, USA).
-
bioRxiv - Immunology 2024Quote: ... Concentration and cDNA size was checked for select representative wells using a High Sensitivity DNA5000 assay for the Tapestation 4200 (Agilent: 5067-5592). cDNA was diluted to an average of 200 pg/µl and 100 pg cDNA from each cell was tagmented by adding 1 µl TD and 0.5 µl ATM from a Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Systems Biology 2024Quote: ... The sequencing libraries were quantified using the Qubit 4 fluorometer and library sizes were quantified using the D1000 ScreenTape assay (Agilent 5067-5582) on the TapeStation 4200 automated electrophoresis platform.
-
bioRxiv - Neuroscience 2024Quote: ... Quality control of the cDNA and final libraries was conducted using the High Sensitivity RNA D5000 and D1000 ScreenTape assays (Agilent Technologies, U.S.A.), respectively ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quality and quantity of the each library was analyzed using an Agilent 2100 Bioanalyzer and Nano Plant RNA assay (Agilent, Vilnius, Lithuania) for quality control ...
-
bioRxiv - Cancer Biology 2024Quote: ... The enriched libraries were quantified using Qubit 2.0 DNA HS Assay and library quality was evaluated by TapeStation HSD1000 ScreenTape (Agilent Technologies, CA, USA). Enriched libraries were pooled before sequencing on an Illumina NovaSeq S4 sequencer for 150 bp read length in paired-end mode.
-
bioRxiv - Cancer Biology 2024Quote: ... Once cells were fully attached their media was changed in Seahorse XF Assay Medium with a pH of 7.4 (Agilent Technologies, 103575-100),10 mM Glucose (Agilent Technologies ...
-
bioRxiv - Cell Biology 2024Quote: RNA integrity post-isolation was analyzed and the ratios of 28S to 18S rRNA in U3 and U8 snoRNA ASO and SCR ASO-treated samples were assayed using the Agilent RNA High Sensitivity Assay (Agilent, 5067-5579) on the 4150 TapeStation system (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... Immunohistochemical reaction was developed using 3, 30-diaminobenzidine tetrahydrochloride (DAB) or Purple Kit (Chromo Map DAB or Purple Kit, Ventana, Roche; DAB (Dako) and nuclei were counterstained with Carazzi’s hematoxylin ...
-
bioRxiv - Genomics 2020Quote: ... The resulting PCR product was purified using the NucleoSpin Gel and PCR Clean-up kit (Machery Nagel) and the correct fragment size was confirmed using a High Sensitivity Bioanalyzer DNA Kit (Agilent). For cloning ...
-
bioRxiv - Genomics 2020Quote: ... The BAMfile used for IGV visualization was generated from WES data obtained with the SureSelect Human All Exon V6 kit (exome capture kit) from Agilent. Group alignment is by chromosome of mate ...
-
bioRxiv - Biochemistry 2022Quote: ... The preparation of variants was achieved through an error-prone PCR mutagenesis kit (GeneMorph II Random Mutagenesis Kit – Agilent Technologies), following the manufacturer’s instructions in order to insure high proportion of single-mutant variants ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL of each PCR reaction was electrophoresed using the ZAG 130 dsDNA Kit (75-20000 bp) or ZAG 110 dsDNA Kit (35-5000 bp) (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... libraries were quantified with qPCR using the NEBnext Library Quant Kit for Illumina and fragment size assessed with TapeStation D1000 kit (Agilent). Libraries were pooled in equimolar concentration and sequenced using an Illumina NovaSeq 6000 and S2 flow cells (100 cycle kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... hEZH2-K381R-Fv: GGAGCTATGATGCTAGATTCCTTGACTCTAAACTCATACAC and hEZH2-K381R-Rv: GTGTATGAGTTTAGAGTCAAGGAATCTAGCATCATAGCTCC with site-directed mutagenesis kit (QuikChange II Site-directed mutagenesis kit, Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... After a cleanup with SPRIselect Reagent Kit and fragment size estimation with High SensitivityTM HS DNA kit runned on 2100 Bioanalyzer (Agilent), the libraries were constructed by performing the following steps ...