Labshake search
Citations for Agilent :
1501 - 1550 of 2281 citations for Mono 2 Ethyl 5 Oxohexyl Phthalate 13C4 99% Dehp Metabolite Vi 100Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... and 5% serum) before analysis of OCR and ECAR in a Metabolic Flux Analyzer (Seahorse Bioscience, North Billerica, MA 96XP).
-
bioRxiv - Cell Biology 2022Quote: ... Non-specific antibody binding was blocked by incubation for 30 min with blocking solution containing 5% normal goat serum (NGS, Dako) at room temperature followed by overnight incubation at 4 °C with different primary antibodies listed in Table 1 ...
-
bioRxiv - Biophysics 2022Quote: ... or aged samples (T ~ 24 hours) were imaged directly in sealed 384-well microwell plates with a BioTek Cytation Gen 5 imaging plate reader (Agilent) using a 20 x objective ...
-
bioRxiv - Cell Biology 2022Quote: ... three 5 μm-thick tissue sections separated by 300 μm were stained with guinea pig anti-insulin antibody (undiluted, Dako IR002 ...
-
bioRxiv - Microbiology 2020Quote: ... and 1 μl was used for a 10 μl qPCR reaction with 5 μl THUNDERBIRD SYBR Green mix (Toyobo) on an Mx3000P qPCR System (Agilent) using the following program ...
-
bioRxiv - Molecular Biology 2020Quote: ... The quality of final single cell 5’ GEX libraries was assessed by Qubit quantification and fragment analysis (DNF-474 High Sensitivity NGS Fragment Analyzer Kit, Agilent). The sequencing was performed on a NextSeq500 device (Illumina ...
-
bioRxiv - Immunology 2019Quote: ... 5×105 CD8+ T-cells were plated onto poly-D-lysine coated wells and assayed in XF RPMI medium (Agilent) pH 7.4 supplemented with 10 mM glucose ...
-
bioRxiv - Biochemistry 2019Quote: ... the HPLC column (2.1 mm x 5 cm C18 reverse phase column from Higgins Analytical) was connected to an LC pump (Agilent 1100G1312A) and cleaned by flowing 200 µL/min of Buffer B (0.1% formic acid in acetonitrile ...
-
bioRxiv - Developmental Biology 2019Quote: ... The mixtures were centrifuged at 16,000g for 5 minutes and the supernatant was injected in an Agilent 1100 HPLC (Agilent Technologies) equipped with a reverse phase column ...
-
bioRxiv - Genomics 2021Quote: ... Between 1 and 5 ng of the purified digested DNA was loaded on a High Sensitivity DNA chip (Agilent Technologies) and run on an Agilent 2100 Bioanalyzer System ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The system was equipped with a 30 m x 0.32 mm x 0.25 μm fused silica capillary column (HP-5, Agilent Technologies, Germany). High purity (99.999% ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 5 μL was loaded on to a reversed-phase column (Agilent Zorbax SB C8, 150 x 2.1 mm, 3.5 μM) through an Agilent 1260 HPLC system for the separation of various venom components ...
-
bioRxiv - Microbiology 2021Quote: ... All other synthetic or expressed peptide substrates were purified and analyzed at small scale utilizing analytical-scale reverse-phase HPLC on an Agilent 1100 series HPLC system (Santa Clara, CA) employing an Eclipse Plus C18 column (5 μm, 4 × 150 mm) (Agilent) at a flow rate of 1 mL/min ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1µg of Hi-C library per sample was mixed with 5 μl of SureSelect XT HS and XT Low Input Blocker Mix (Agilent). Samples were denatured at 95°C for 5 minutes and pre-hybridized for 10 minutes at 65°C ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: To calculate LOD and LOQ of phthalates we used the standard deviation of the first point of the curve that had a signal-to-noise ratio SNR>5 given by Agilent Mass Hunter Qualitative Analysis B.06.00 that calculates the distance from the height of the peak to the midline between the maximum and minimum noise at baseline ...
-
bioRxiv - Developmental Biology 2021Quote: ... pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent). The same kit was used to sequentially remove three nucleotides located at the 5’ end of the pCS2+-3’HA-sobp ORF to generate a construct whose transcribed mRNA does not bind to the designed translation-blocking antisense morpholino oligonucleotide (pCS2+-sobpMOI-3’HA ...
-
bioRxiv - Microbiology 2020Quote: ... The supernatant (5 μL) was injected into the Agilent 7890 gas chromatograph equipped with an electron capture detector (Agilent, USA), which was used to determine the short-chain fatty acids of A ...
-
bioRxiv - Immunology 2020Quote: ... These genes were cloned into an Adenovirus type 5 replication-defective E1/E3 deleted vector using the Ad-Easy Adenoviral Vector System (Agilent). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... Mutagenesis of the A2REs in the Ins1 5’-UTR was performed with the QuikChange II Site-directed mutagenesis kit (Agilent). Cells were co-transfected with each pNL1.1 construct and the pGL4.54 for normalization ...
-
p97/VCP induces GLI1 to control XBP1-dependent endoplasmic reticulum stress transcriptional responsebioRxiv - Cancer Biology 2021Quote: ... The cells were washed 3 times with PBS for 5 min and then incubated with a secondary antibody: Flex-HRP (EnVision System, Dako) for 30 min and washed 3 times 5 min with PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... the samples were denatured in the presence of the specific probe at 75°C for 5 min and left overnight for hybridization at 37°C in a hybridizer machine (DAKO). The probes used detect copy number alterations in chromosomes 7 and 8 (KBI-20031 ...
-
bioRxiv - Plant Biology 2023Quote: ... and 5 μL injected into an Infinity HPLC 1300 coupled to an 6495 QqQ mass spectrometer (Agilent Technologies, Santa Clara). Peptides were loaded onto a C18 120 Å 2.7 μm 2.1 × 250 mm peptide mapping column held at 60 °C ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... then incubated with a goat anti-rabbit HRP-conjugated secondary antibody (Dako P0448, 1:2000 dilution in 5% BSA-PBST) for 2 hours at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Microbiology 2022Quote: ... 23S and 16S rRNA are separately isolated to purity from the large RNA fraction following HPLC using the Bio SEC-5 column (Agilent; 7.8 mm ...
-
bioRxiv - Systems Biology 2024Quote: ... elav (Developmental Studies Hybridoma Bank, 9F8A9 at 1:20 and 7E8A10 at 1:5) and PCNA (DAKO, MO879, 1:500). For immunofluorescence studies ...
-
bioRxiv - Immunology 2024Quote: ... Greyhound Chemicals), 10% LC-MS grade water (Ultra CHROMASOLV, Honeywell Riedel-de Haën) with 5 uM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Developmental Biology 2024Quote: Amplicons per sample were pooled to a maximum concentration of 5 ng/µl and assessed for DNA quality using a fragment analyzer (Agilent) and the Qubit™ dsDNA HS Assay kit (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... and 280 nm with a Eclipse Plus Phenyl-Hexyl column (250 mm length, 4.6 mm diameter, 5 μm particle size, Agilent Technologies). The flow rate was set to 0.5 mL/min for a 70/30 combination of the mobile phase in water and acetonitrile (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2023Quote: ... The sample (5 µl injection volume) was separated on a ZORBAX Eclipse Plus C18 (2.1×50 mm, 1.8 µm, Agilent Technologies, Inc.). Data analysis was performed with Agilent Profinder (v10.0 SP1 ...
-
bioRxiv - Physiology 2023Quote: HPLC separation was performed on an Agilent 1100 HPLC system using a 5 µm C18 column (4.6 mm × 150 mm, Agilent-XDB), maintained at 30°C ...
-
bioRxiv - Cell Biology 2024Quote: The fluorescence from mNG21-10/mNG211 complementation was visualized the day after transfection with the pH2B-mNG211 plasmid using a Cytation 5 microscope (Agilent) equipped with a 20x/0.45 NA phase contrast objective ...
-
bioRxiv - Biochemistry 2024Quote: ... The volatile components were separated by a DB-5 capillary column (30 m × 0.25 mm × 0.25 μm, Agilent, CA, USA) using high-purity helium as carrier gas with a 1.5 mL/min flow rate ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Bioengineering 2024Quote: ... Two-channel 85 µm z-stack images were taken using a Cytation 5 V3.14 cell imaging multi-mode reader (Agilent Technologies). A total of 21 z-stacks per well and per experiment were recorded and used for post-processing to calculate the cell phenotypic response in each hydrogel model.
-
bioRxiv - Microbiology 2023Quote: ... GC/MS analysis was performed on a Trace GC Ultra gas chromatograph with AS3000 Autosampler equipped with a Zorborbax DB-5 column (30 m, 0.25 mm i.d., 0.20 μm film thickness; Agilent J&W Scientific), with the eluate transferred at 280 °C to a Polaris Q mass spectrometer (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng of the protein extracts were run through a home-packed PLRP-S capillary column (200 mm long, 0.25 mm i.d., 5 μm particle size, 1000 Å pore size; Agilent Technology). The column was heated to 60 °C at an 8 μL/min flow rate ...
-
bioRxiv - Bioengineering 2023Quote: ... The luminescence signal which represents the amount of ATP in viable cells was measured with a microtiter well plate reader (BioTek Cytation 5, Agilent).
-
bioRxiv - Systems Biology 2023Quote: ... we used an Eclipse Plus Phenyl-Hexyl column (250 mm length, 4.6 mm diameter, 5 µm particle size, Agilent Technologies) and a Diode Array Detector (G4212 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were spun down 500 g for 5 min followed by sealing with optical clear permanent seal (Agilent, 24212-001) using the Plateloc Thermal Microplate Sealer (Agilent) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were centrifuged (20,000 x g for 10 min) and desalted using 5 uL C18 cartridges on the AssayMap BRAVO platform (Agilent Technologies). For each sample ...
-
bioRxiv - Cell Biology 2023Quote: ... then incubated with a goat anti-rabbit HRP-conjugated secondary antibody (Dako P0448, 1:2000 dilution in 5% BSA-PBST) for 2 hours at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... 10μL of purified protein was injected to a C-18 column (Agilent Zorbax 300SB-C18, 5 μM, 2.1 x 150mm) without dilution or buffer exchange ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed three times with 1x PBST for 5 min and incubated with secondary antibodies anti-mouse-HRP (1:10,000) (Agilent Dako, #P0447) and anti-rabbit-HRP (1:10,000 ...
-
bioRxiv - Microbiology 2023Quote: BAs in liver tissue and cecum content were extracted with methanol and 5 μL was injected onto a reverse-phased chromatography (1290 Infinity II, Agilent) and mass spectrometer (6546 Q-TOF/MS ...
-
bioRxiv - Biochemistry 2023Quote: ... The filtrate was injected into a C18 reversed-phase column (4.6 mm×150 mm, 5 μm particle size, Agilent, USA) in a Thermo-Fisher Ultimate 3000 separation module equipped with a DAD-3000 Diode Array Detector ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Five μL of analyte was applied to an Eclipse XDB-C18 column (150 x 4.6 mm, 5 μm, Agilent Technologies) and separated using the following gradient at 1 mL/min ...