Labshake search
Citations for Agilent :
1451 - 1500 of 7579 citations for Rat Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: BAs in liver tissue and cecum content were extracted with methanol and 5 μL was injected onto a reverse-phased chromatography (1290 Infinity II, Agilent) and mass spectrometer (6546 Q-TOF/MS ...
-
bioRxiv - Biochemistry 2023Quote: ... The filtrate was injected into a C18 reversed-phase column (4.6 mm×150 mm, 5 μm particle size, Agilent, USA) in a Thermo-Fisher Ultimate 3000 separation module equipped with a DAD-3000 Diode Array Detector ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Five μL of analyte was applied to an Eclipse XDB-C18 column (150 x 4.6 mm, 5 μm, Agilent Technologies) and separated using the following gradient at 1 mL/min ...
-
bioRxiv - Biochemistry 2023Quote: ... Online HPLC was performed on a U3000 RSLC nano Pro-flow system using a C3 column (Zorbax 300SB-C3, 5 µm; Agilent). Samples were maintained at 4 °C and 1 µL injected for each analysis using a microliter pickup ...
-
bioRxiv - Cancer Biology 2023Quote: 250 M10M6-PtenC124S cells and 750 M10M6-PtenWT cells were seeded in 384 well plate with 40 µL RPMI-1640 medium containing 5% FBS using Bravo automated liquid handling platform (Agilent). After 24 hours ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 μg of TMT-labeled peptides were loaded onto 10 cm capillary columns packed with 5 μM Zorbax SB-C18 (Agilent), which was connected using a zero dead volume 1 μm filter (Upchurch ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were then transferred immediately into a 5 mm NMR tube (Wilmad) and placed into a 600 MHz magnet with a coldprobe (Agilent). The peptide backbone was assigned using a combination of BEST versions of 3D HNCA ...
-
bioRxiv - Systems Biology 2023Quote: ... the peptides were reconstituted in 10 mM TEAB and fractionated using a bRPLC column (Agilent 300 Extend-C18 column, 5 µm, 4.6 mm × 250 mm, Agilent Technologies) under an increasing gradient of the mobile phases consisting of 10 mM TEAB in water and 90% acetonitrile (ACN) ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were washed in PBS and incubated in DAPI (1:500) for 5 min before mounting with the immunofluorescence mounting media (DAKO).
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Molecular Biology 2023Quote: TEV eluates (about 650-700 µl) were partially digested for 5 min at 37 °C with 25 µl of RNase-IT (Agilent) diluted to 1:50 in TNM100 buffer and the reactions were stopped using 0.4 g guanidine hydrochloride ...
-
bioRxiv - Bioengineering 2023Quote: ... slides were counterstained with DAPI (1µg/ml) in PBS for 5 min followed by water washes and cover slipping with fluorescent antifade mounting reagent (DAKO, Agilent).
-
bioRxiv - Cancer Biology 2023Quote: ... 2000 cells were seeded on a well of a 96-well plate and brightfield images were taken every two hours by using the BioTek BioSpa 8 Automated Incubator and Citation 5 reader (Agilent). BioTek Gen5 imaging software (Agilent ...
-
bioRxiv - Immunology 2023Quote: ... We performed the HPLC with a normal phase Zobax Sil (5 μm, 4.6 × 150 mm) column (Agilent, Santa Clara, CA). Isocratic chromatographic separation was achieved with 10% ethyl acetate/hexane at a flow rate of 1.4 ml/min ...
-
bioRxiv - Bioengineering 2023Quote: ... Peptides were loaded to a nanoscale HPLC column composed of 10 cm of Polaris C18 5 μm packing material (Agilent), followed by 4 cm of Partisphere 5 SCX (Whatman) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Systems Biology 2024Quote: ... elav (Developmental Studies Hybridoma Bank, 9F8A9 at 1:20 and 7E8A10 at 1:5) and PCNA (DAKO, MO879, 1:500). For immunofluorescence studies ...
-
bioRxiv - Neuroscience 2023Quote: ... the incubation time for oligomycin during the assay was increased to 15 min to allow for proper diffusion into the slices and the final toxin concentrations were increased to 5 μM for oligomycin and 2 μM for rotenone/antimycin (Agilent). The ATP production was normalised to the FO slice protein content as measured by Nanodrop (Implen).
-
bioRxiv - Immunology 2024Quote: ... Greyhound Chemicals), 10% LC-MS grade water (Ultra CHROMASOLV, Honeywell Riedel-de Haën) with 5 uM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Developmental Biology 2024Quote: Amplicons per sample were pooled to a maximum concentration of 5 ng/µl and assessed for DNA quality using a fragment analyzer (Agilent) and the Qubit™ dsDNA HS Assay kit (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... The sample (5 µl injection volume) was separated on a ZORBAX Eclipse Plus C18 (2.1×50 mm, 1.8 µm, Agilent Technologies, Inc.). Data analysis was performed with Agilent Profinder (v10.0 SP1 ...
-
bioRxiv - Physiology 2023Quote: HPLC separation was performed on an Agilent 1100 HPLC system using a 5 µm C18 column (4.6 mm × 150 mm, Agilent-XDB), maintained at 30°C ...
-
bioRxiv - Microbiology 2024Quote: ... and 280 nm with a Eclipse Plus Phenyl-Hexyl column (250 mm length, 4.6 mm diameter, 5 μm particle size, Agilent Technologies). The flow rate was set to 0.5 mL/min for a 70/30 combination of the mobile phase in water and acetonitrile (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... The volatile components were separated by a DB-5 capillary column (30 m × 0.25 mm × 0.25 μm, Agilent, CA, USA) using high-purity helium as carrier gas with a 1.5 mL/min flow rate ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cell Biology 2024Quote: The fluorescence from mNG21-10/mNG211 complementation was visualized the day after transfection with the pH2B-mNG211 plasmid using a Cytation 5 microscope (Agilent) equipped with a 20x/0.45 NA phase contrast objective ...
-
bioRxiv - Physiology 2022Quote: ... and mBaSVF cells were seeded in an XF24 cell culture microplate (Agilent Technologies, 102342-100) at a density of 20,000 cells per well ...
-
bioRxiv - Cell Biology 2021Quote: Dissociated cells were plated at 25,000 cells per well in a 96-well microplate (Agilent). One week after plating ...
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... 50,000 cells/well were seeded into a Seahorse XF 96-well cell culture microplate (Agilent) in DMEM and incubated for at least 4 hours at 37 °C with 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS or U2OSp53KO cells were seeded in XF96-well cell culture microplates (Agilent, #101085-004) at 30,000 cells/well in high glucose and incubated at 37°C in 5% CO2 overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... and seeded at 10,000 cells/well in 96 well Seahorse XF cell culture plates (Agilent). The sensor cartridges were hydrated overnight with tissue culture grade H2O in a non-CO2 incubator at 37°C as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were seeded overnight in Seahorse XF96 V3PS cell culture microplates (Agilent Technologies, 101085-004) and allowed cell attached the plates and then treated with indicated drugs for indicated time ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Cell viability was monitored using the xCELLigence MP Real-Time Cell Analysis (RTCA) system (Agilent) as previously described [14] ...
-
bioRxiv - Cell Biology 2023Quote: ... Fifteen thousand cells per well were seeded on XFe96 cell culture microplates (Agilent #102416-100) one day before the experiment ...
-
bioRxiv - Cell Biology 2024Quote: Cell impedance was measured using a Real Time Cell Analyzer (RTCA; Agilent, Santa Clara, CA). Before adding 30,000 cells to each well ...
-
bioRxiv - Synthetic Biology 2021Quote: ... using the GeneMorph II random mutagenesis kit (Agilent, USA). The generated PCR products were inserted back into the respective backbones using Gibson Assembly ...
-
bioRxiv - Cell Biology 2020Quote: ... ookinete and sporozoites using an RNA purification kit (Stratagene). cDNA was synthesised using an RNA-to-cDNA kit (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quality control for constructed library was performed by Agilent Bioanalyzer High Sensitivity DNA kit (Agilent Technologies, 5067-4626) for qualitative analysis ...
-
bioRxiv - Genetics 2021Quote: ... and subcloned using Strataclone PCR Cloning Kit (Agilent 240205). Either Donorguide or ssODN injected zebrafish were combined ...
-
bioRxiv - Developmental Biology 2021Quote: ... together with Bioanalyser High Sensitivity RNA Anlysis Kit (Agilent). 1 ng of RNA template was subjected to cDNA synthesis using SuperScript™ VILO™ cDNA Synthesis Kit (Thermo Fisher) ...
-
bioRxiv - Immunology 2020Quote: ... and quality assessed by Bioanalyser (DNA HS Kit, Agilent). Libraries were then constructed from 150 pg of cDNA using the Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Developmental Biology 2020Quote: ... with the High Sensitivity DNA Kit (5067-4626, Agilent). The sequencing libraries were prepared using the KAPA Hyper Pre-Kit (KR0961 – v6.17 ...
-
bioRxiv - Genomics 2020Quote: ... Total RNA isolated using the RNA extraction kit (Agilent) as per manufacturing instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... using the Quikchange II XL mutagenesis kit (Agilent Technologies). These vectors were recombined via Gateway technology to pDONR-Zeo vectors (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... using the Quikchange II XL mutagenesis kit (Agilent Technologies). 2 ...
-
bioRxiv - Cancer Biology 2019Quote: Agilent SureSelectXT library prep ILM Kit (Agilent Technologies, #G9611A) was used to prepare the library for each sheared mouse DNA sample ...
-
bioRxiv - Immunology 2019Quote: Seahorse XF Mito Stress test kits and cartridges (Agilent) were prepared per manufacturers protocol and as previously described (Bossche et al. ...
-
bioRxiv - Systems Biology 2019Quote: ... according to Agilent microRNA Hybridization Kit protocol (Agilent, UK) and scanned using Agilent G2505B array scanner ...
-
bioRxiv - Systems Biology 2019Quote: ... and polished with a PCR polishing kit (Agilent, # 200409) to generate blunt-end DNA ...
-
bioRxiv - Neuroscience 2019Quote: ... and RNA integrity was determined by Agilent 2100 bioanalyzer and RNA 6000 Nano kit (Agilent Technologies). Paired-end libraries were synthesized using the TruSeq RNA library preparation kit (Illumina) ...