Labshake search
Citations for Agilent :
1701 - 1750 of 7579 citations for Rat Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... Twenty microliters of the EPP and UPP extracts were separately injected into a Bio SEC-5 column (4.6×300 mm, 500 Å, Agilent Technologies), maintained at 25°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein samples were first desalted on a reverse phase-C8 cartridge (Zorbax 300SB-C8, 5 mm, 300 µm ID’5mm, Agilent Technologies) for 3 min at a flow rate of 50 ml/min with 100% solvent A and then eluted with 70% solvent B at a flow rate of 50 ml/min for MS detection ...
-
bioRxiv - Biochemistry 2022Quote: ... C238P mutations were introduced step-wise into pDONR221-AR-AD-TAU-5* (bearing L26P, A186P, L192P and C238P mutation and previously described) using a Quickchange™ protocol with Pfu Turbo polymerase (Agilent) and the following primer pairs to generate pDONR221-AR-AD-L56P+Tau-1+Tau-5*:
-
bioRxiv - Microbiology 2023Quote: ... approximately 2 µg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Cell Biology 2023Quote: ... frozen femur sections were blocked with 3% BSA and 5% goat serum in PBS, incubated with Cgrp antibody (rabbit polyclonal, abcam #ab47027, 1:300 in DAKO antibody diluent (Agilent, #S0809)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed three times with 1x PBST for 5 min and incubated with secondary antibodies anti-mouse-HRP (1:10,000) (Agilent Dako, #P0447) and anti-rabbit-HRP (1:10,000 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... held for 5 min and connected to the GC-MS (Agilent 7890B GC and 5977 MS, Agilent Technologies, Palo Alto, USA) via a heated transfer line (300 °C) ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was additionally purified with ZymoResearch DNA Clean & Concentrator-5 columns (D4003T) and digested DNA profiles confirmed using the 2100 Bioanalyzer with the Agilent DNA High Sensitivity chip (Agilent Technologies). The libraries were then prepared using the Qiaseq Ultra Low Input Library Kit (Qiagen) ...
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Neuroscience 2023Quote: ... Chromatography was carried out using a Zorbax SB C18 column (150 × 2.1 mm, 5 µm, Zorbax, Agilent, Santa Clara, CA, USA) which was proceeded with a SB-C18 Guard Cartridges (12.5 × 2.1 mm ...
-
bioRxiv - Genetics 2023Quote: ... we inserted a wild-type histone array sequence containing the 5 replication-dependent histone genes into a pBluescript II KS+ vector (Agilent #212207) and introduced mutations using a Q5 Site-Directed PCR Mutagenesis Kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... muropeptide originating from peptidoglycan extracted from the same number of cells (1.5×109) were analyzed by reverse phase-ultra high-pressure liquid chromatography (RP-UHPLC) using a 1290 chromatography system (Agilent Technologies) equipped with a Zorbax Eclipse Plus C18 RRHD column (100×2.1 mm ...
-
bioRxiv - Cell Biology 2023Quote: ... Sections were washed three times for 5 min each in TBST and mouted with flourescence mounting medium (Dako, Santa Clara, USA). Images of immunofluorescence secitons were captured by confocal microcopy FV1000 (Olympus ...
-
bioRxiv - Bioengineering 2023Quote: ... slides were counterstained with DAPI (1µg/ml) in PBS for 5 min followed by water washes and cover slipping with fluorescent antifade mounting reagent (DAKO, Agilent).
-
bioRxiv - Physiology 2024Quote: ... were subjected to quantitative PCR under a temperature profile of 95°C for 3 min followed by 40 cycles for 95°C for 5 sec and 58°C for 15 sec using the Stratagene Mx3000P (Agilent Technologies). For each of the samples ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Fluorescence of supernatants was measured at 555/596 nm excitation/emission wavelength (Cytation 5 Multi-Mode Microplate Reader, Agilent, Waldbronn, Germany). 1X alamarBlue reagent solution in ALI medium was used as blank.
-
bioRxiv - Neuroscience 2024Quote: ... 6.5-9) and concentration (5-50 ng/µl; 260/280 values >1.7) were evaluated using the Agilent 2100 Bioanalyzer (Agilent Technologies, CA) and Nanodrop (Thermo-fisher ...
-
bioRxiv - Microbiology 2024Quote: ... approximately 2 μg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 μm, 300Å, 1x75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 μl/min (solvent A ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were washed 5 x 15 min in PBST at RT and slides were mounted in DAKO fluorescent mounting medium (Agilent Technologies). EdU staining was performed on sections from larvae that received an EdU pulse ...
-
bioRxiv - Cancer Biology 2024Quote: ... using miR30-adapted sequences (5-6 shRNAs per target) by PCR-cloning a pool of oligonucleotides synthesized on 55k customized arrays (Agilent Technologies) using a well-established system 84–87 ...
-
bioRxiv - Bioengineering 2024Quote: ... Fluorescence was quantified using an excitation of 530/15 nm and emission of 590/15 nm on a fluorescent plate reader (BioTek Cytation 5, Agilent Technologies).
-
bioRxiv - Bioengineering 2024Quote: ... DMMB solution was added (200 µL/well) and absorbance was measured at 540 nm and 590 nm using a plate reader (BioTek Cytation 5, Agilent Technologies). For all samples ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 µL of eluted RNA and 5 µL RNA ScreenTape sample buffer was mixed in an 8-well PCR tube strip (Agilent Technologies) via vortexing for one minute (IKA MS3 Vortexer ...
-
bioRxiv - Cell Biology 2020Quote: ... BL-21(DE3) competent cells (Agilent) were transformed with the plasmid following supplier protocol and plated on LB agar plated with ampicillin selection overnight at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... coli XL1Blue super-competent cells (Agilent) for propagation ...
-
bioRxiv - Biochemistry 2020Quote: ... coli Arctic Express DE3 cells (Agilent) with a GST tag on its N-terminus ...
-
bioRxiv - Biochemistry 2020Quote: ... coli Arctic Express DE3 cells (Agilent) with a GST tag on its N-terminus ...
-
bioRxiv - Biochemistry 2020Quote: ... coli BL21(DE3) cells (200131, Agilent) and purified according to standard procedures as previously described (15) ...
-
bioRxiv - Microbiology 2021Quote: ... coli XL10-Gold competent cells (Agilent) before being moved into E ...
-
bioRxiv - Biophysics 2020Quote: ... coli BL21-Gold (DE3) cells (Agilent) using lysogeny broth (LB ...
-
bioRxiv - Cell Biology 2020Quote: E.coli ArcticExpress DE3 cells (Agilent, #230192) were grown overnight in 5 ml LB supplemented with the respective antibiotic for the expression vector ...
-
bioRxiv - Cell Biology 2022Quote: BL21 – CodonPlus competent cells (Agilent Technologies) were transformed with a plasmid encoding the GST-tagged domain of Rhotekin (Addgene plasmid # 15247) ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli BL21-Gold (DE3) cells (Agilent) from the pProEXHTb expression vector (Invitrogen) ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV 293 cells (#CVCL_6871, Agilent, USA) used for vector productions were maintained in DMEM (# 41965062 ...
-
bioRxiv - Biochemistry 2022Quote: ... coli BL21 (DE3) competent cells (Agilent). Transformants from a single colony were used to inoculate 5 mL of LB supplemented with 100 mg/L kanamycin (LB-Kan ...
-
bioRxiv - Biochemistry 2021Quote: ... coli BL21(DE3) Gold cells (Agilent) were co-transformed with recombinant pET11a-N-GFP and pMRBAD-C-GFP vectors so that several combinations were tested ...
-
bioRxiv - Biophysics 2020Quote: ... or Gold BL21(DE3) cells (Agilent) and purified using a FF HisTrap column ...
-
bioRxiv - Biophysics 2019Quote: ... coli XL-1 Blue cells (Agilent). The entire reading frame of each plasmid was verified by DNA sequencing ...
-
bioRxiv - Biophysics 2019Quote: ... coli BL21-Gold (DE3) cells (Agilent) for protein expression.
-
bioRxiv - Biochemistry 2019Quote: ... coli ArcticExpress (DE3)-RIL cells (Agilent). Cells were grown in TB medium at 37°C until they reached an OD600 of 0.6-0.8 ...
-
bioRxiv - Immunology 2020Quote: ... coated XF96 cell culture microplate (Agilent) with a density of 100’000 or 150’000 cells/well and rested in Seahorse XF RMPI 1640 medium supplemented with 2 mM L-glutamine ...
-
bioRxiv - Cell Biology 2021Quote: ... coli BL21 (DE3) Gold cells (Stratagene). For large scale expression ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were mounted with Fluoromount (Dako). Images were taken using a confocal laser scanning microscope (Zeiss LSM 700).
-
bioRxiv - Biophysics 2020Quote: ... coli BL21 (DE3) RIL cells (Agilent) and expression was induced with 1 mM IPTG for 20 h at 18 °C with continuous agitation at 200 RPM in LB media ...
-
bioRxiv - Microbiology 2021Quote: ... coli XL-10 gold cells (Stratagene). After sequencing ...
-
bioRxiv - Immunology 2020Quote: ... coli BL21(DE3) RIPL cells (Agilent) as previously described 18 ...
-
bioRxiv - Biophysics 2022Quote: ... coli BL21-Gold (DE3) cells (Agilent) were transformed with a modified pET 28a vector encoding N-terminal 7X His tagged MSP with a mutated cysteine at position 277 for biotinylation ...
-
bioRxiv - Cell Biology 2022Quote: ... BL-21(DE3) competent cells (Agilent) were transformed with the plasmids following supplier protocol and plated on LB agar plated with kanamycin selection overnight at 37 °C ...