Labshake search
Citations for Agilent :
1451 - 1500 of 6807 citations for Creatinine Serum Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: 2 × 105 BMDMs were plated into each well of Seahorse XF96 cell culture microplates (Agilent Technologies) and cultured overnight before treated with or without 20 ng/ml IL-4 for 6 or 24 h or ACs for 3 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of the ligation product was transformed into bacteria using XL10-Gold Ultracompetent Cells (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... then stained with: rabbit polyclonal (pAb) glial fibrillary acidic protein (GFAP,1:1000, Dako, Z033401-2), goat pAb glial fibrillary acidic protein (GFAP,1:300 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The following antibodies were incubated overnight at 4°C: rat anti-human CD31 (DAKO, M082329-2), rabbit anti-human S1PR1 (Santa Cruz ...
-
bioRxiv - Microbiology 2019Quote: ... parasites received doses up to 9000 J m−2 using a Stratalinker® UV crosslinker (Stratagene). After incubation at 37 °C under a 5 % CO2 atmosphere for 3 days ...
-
bioRxiv - Immunology 2019Quote: ... Calibration beads were stained with F(ab’)2 FITC-Conjugated Goat Anti-Mouse immunoglobulins (Dako, F0479) at 1:50 dilution for 1 hr at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... equipped with a 80/100 alumina column (1/8” x 2 mm x 1.5 m, Agilent) and set with the following parameters ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated for 2 hours in biotinylated swine anti-rabbit secondary antibody (1:200, Dako) followed by 2-hour incubation in Vectastain ABC (avidin-biotin ...
-
bioRxiv - Cancer Biology 2022Quote: ... Absorbance was measured at 564 nm with a Synergy 2 Multi-Detection Microplate Reader (Agilent Technologies) and normalized to a vehicle control ...
-
bioRxiv - Immunology 2020Quote: ... Thermo Fisher MA USA) followed by SA-HRP (1:2000 dilution, #P030701-2, Dako, CA USA), and visualised with TMB (#421101 ...
-
bioRxiv - Biochemistry 2022Quote: Anthocyanins were quantified using a UHPLC–DAD Agilent 1290 Infinity system (Agilent Technologies, USA; System 2). The UHPLC consisted of a diode-array (DAD ...
-
bioRxiv - Neuroscience 2019Quote: ... libraries were sized using 2 μL of cDNA libraries to run HSD1000 ScreenTape (Agilent #5067-5584) on the Agilent Technologies 2200 TapeStation ...
-
bioRxiv - Immunology 2020Quote: ... The RBD domain of SARS-CoV-2 S was biotinylated and tetramerized with streptavidin-APC (Agilent). The APC decoy reagent was generated by conjugating SA-APC to Dylight 755 using a DyLight 755 antibody labeling kit (ThermoFisher) ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 µl of the solution was separated on a gas chromatograph (GC 7890A; Agilent Technologies) equipped with a Phenomenex ZB-35 (30m × 0.25mm × 0.25µm ...
-
bioRxiv - Neuroscience 2020Quote: ... transferred on glass slides and mounted for visualization with anti-fading mounting medium (Agilent #S302380-2). Confocal images were acquired using a Nikon Eclipse C1si laser-scanning microscope equipped with a 20x (NA 0.75 ...
-
bioRxiv - Biochemistry 2021Quote: ... in 2 mL headspace vials and analysed on an HPLC instrument (Agilent Technologies, 1260 Infinity II); peaks were identified using pure standards ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of the ligation product was transformed into bacteria using XL10-Gold Ultracompetent Cells (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... slides were blotted with the following primary antibodies: anti-insulin (IR00261-2, 1:4; Agilent Techologies) and anti-glucagon (g2654 ...
-
bioRxiv - Cell Biology 2021Quote: ... The pEGFP-C2-Myo15-2(jd) plasmid was generated using site directed mutagenesis (QuikChange II, Agilent) to introduce the jordan (c.4940A>G ...
-
bioRxiv - Immunology 2021Quote: 2 × 105 BMDMs were plated into each well of Seahorse XF96 cell culture microplates (Agilent Technologies) and cultured overnight before treated with or without LPS plus ATP ...
-
bioRxiv - Cell Biology 2022Quote: ... Antibodies against EGFR (2-18C9) and Ki-67 (M1B1) were obtained from Agilent (Santa Clara, CA). The anti-MCT1 antibody was obtained from Merck (Rockville ...
-
bioRxiv - Genomics 2022Quote: ... Sections were incubated for 5min with hematoxylin (SigmaAldrich) followed by 2 min in bluing buffer (DAKO) and 10s in eosin Y (0.45M ...
-
bioRxiv - Neuroscience 2022Quote: ... and were subsequently incubated with goat anti-rabbit labelled polymer EnVision+ Single Reagent (Dako, K400311-2) for 30 min at RT and peroxidase activity was revealed using DAB+ (Dako ...
-
bioRxiv - Neuroscience 2023Quote: ... the labelled antibodies were developed with a Dako Liquid DAB+ substrate chromogen system (Dako; GV82511-2).
-
bioRxiv - Cell Biology 2023Quote: ... Optical density (OD) was measured with a BioTek Epoch 2 microplate spectrophotometer (Agilent, Santa Clara, CA) for at least 15 min to obtain blank values for each well at the target temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... Slides were then mounted with Dako fluorescence mounting media (S302380-2, Agilent Technologies, Santa Clara, US). The primary antibodies and respective concentrations used in this study are the following ...
-
bioRxiv - Neuroscience 2023Quote: ... we mounted the cultures on glass slides with DAKO anti-fading mounting medium (#S302380 − 2, Agilent) for confocal microscope imaging.
-
bioRxiv - Bioengineering 2022Quote: ... the sections were buffered in DAKO wash buffer (Cat #K800721-2, Agilent, Santa Clara, CA, USA) before incubating in primary antibody diluted in DAKO antibody diluent (Cat# S080983-2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and anti-CD45 clone 2B11 + PD7/26 (Ready-to-use, Agilent Dako cat. no. GA75161-2). After washing away the primary antibodies ...
-
bioRxiv - Cancer Biology 2022Quote: ... and anti-CD45 clone 2B11 + PD7/26 (Ready-to-use, Agilent Dako cat. no. GA75161-2). After washing away the primary antibodies ...
-
bioRxiv - Cancer Biology 2022Quote: ... The coverslips were then mounted on slides using DAKO Faramount Aqueous Mounting Medium (Agilent, #S302580-2). The slides were kept for 24h to allow the mounting media to cure before use.
-
bioRxiv - Bioengineering 2023Quote: ... we mounted the cultures on glass slides with DAKO anti-fading mounting medium (#S302380 − 2, Agilent) for confocal microscope imaging.
-
bioRxiv - Molecular Biology 2023Quote: ... or rabbit anti-goat IgG (500 ng ml−1, 1% BSA in PBST; Agilent, P044901-2), for 1 hour at room temperature ...
-
bioRxiv - Genomics 2023Quote: ... then air dried and mounted using an aqueous fluorescence mounting medium (Agilent Dako, Cat# S302380-2). Cells were visualized and imaged using an Olympus UPLXAPO 20×/0.8 NA air objective on a spinning disk confocal microscope (SpinSR10 ...
-
bioRxiv - Genomics 2023Quote: ... then air dried and mounted using an aqueous fluorescence mounting medium (Agilent Dako, Cat# S302380-2). Cells were visualized and imaged using an Olympus UPLXAPO 20×/0.8 NA air objective on a spinning disk confocal microscope (SpinSR10 ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated 10 minutes in H2O2 solution (S202386-2, Agilent Technologies, Santa Clara, CA, USA) to quench endogenous peroxidases ...
-
bioRxiv - Cancer Biology 2024Quote: ... gaskets were removed and slides were mounted onto coverslips using Fluorescence Mounting Medium (S302380-2, Agilent). Images were acquired using a Zeiss Axio Scope.A1 fluorescence microscope with 40× and 100x magnifications and further analyzed with ImageJ ...
-
bioRxiv - Cancer Biology 2021Quote: ... Immunohistochemical reaction was developed using 3, 30-diaminobenzidine tetrahydrochloride (DAB) or Purple Kit (Chromo Map DAB or Purple Kit, Ventana, Roche; DAB (Dako) and nuclei were counterstained with Carazzi’s hematoxylin ...
-
bioRxiv - Genomics 2020Quote: ... The resulting PCR product was purified using the NucleoSpin Gel and PCR Clean-up kit (Machery Nagel) and the correct fragment size was confirmed using a High Sensitivity Bioanalyzer DNA Kit (Agilent). For cloning ...
-
bioRxiv - Genomics 2019Quote: ... RNA was quantified using the Qubit RNA broad spectrum kit and purity confirmed using the RNA 6000 pico kit on a bioanalyzer (Agilent).
-
bioRxiv - Genomics 2019Quote: ... WES libraries were prepared using the SeqCap EZ Exome Kit v3 (NimbleGen) or the SureSelect Human All Exon V7 Low Input Exome kit (Agilent). Equimolar pooled libraries were sequenced on HiSeq 2000 and 4000 instruments (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: RNA quantity was determined on the Qubit using the Qubit RNA Assay Kit (Life Tech) and RNA quality was determined on the Bioanalyzer using the RNA Pico Kit (Agilent). Using the NEB Next Ultra RNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... The BAMfile used for IGV visualization was generated from WES data obtained with the SureSelect Human All Exon V6 kit (exome capture kit) from Agilent. Group alignment is by chromosome of mate ...
-
bioRxiv - Biochemistry 2022Quote: ... The preparation of variants was achieved through an error-prone PCR mutagenesis kit (GeneMorph II Random Mutagenesis Kit – Agilent Technologies), following the manufacturer’s instructions in order to insure high proportion of single-mutant variants ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL of each PCR reaction was electrophoresed using the ZAG 130 dsDNA Kit (75-20000 bp) or ZAG 110 dsDNA Kit (35-5000 bp) (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... libraries were quantified with qPCR using the NEBnext Library Quant Kit for Illumina and fragment size assessed with TapeStation D1000 kit (Agilent). Libraries were pooled in equimolar concentration and sequenced using an Illumina NovaSeq 6000 and S2 flow cells (100 cycle kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... hEZH2-K381R-Fv: GGAGCTATGATGCTAGATTCCTTGACTCTAAACTCATACAC and hEZH2-K381R-Rv: GTGTATGAGTTTAGAGTCAAGGAATCTAGCATCATAGCTCC with site-directed mutagenesis kit (QuikChange II Site-directed mutagenesis kit, Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Real-time changes in metabolism were tested using a Seahorse XFe96 Analyzer in conjunction with the Seahorse XF Glycolysis Stress Test Assay Kit and the Seahorse XF Real-time ATP Assay Rate Kit (Agilent). Manufacturer instructions were followed to perform each of the assays ...
-
bioRxiv - Genetics 2019Quote: ... Final Hi-C libraries were quantified using Qubit dsDNA HS assay kit and a DNA HS kit on a 2100 Bioanalyzer (Agilent). Libraries were first pooled and shallow sequenced on an Illumina MiSeq (2×84bp paired-end ...
-
bioRxiv - Cell Biology 2020Quote: ... After a cleanup with SPRIselect Reagent Kit and fragment size estimation with High SensitivityTM HS DNA kit runned on 2100 Bioanalyzer (Agilent), the libraries were constructed by performing the following steps ...