Labshake search
Citations for Agilent :
1451 - 1500 of 4255 citations for 6H 1 2 Thiazine 6 ethoxy 5 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Microbiology 2022Quote: ... 23S and 16S rRNA are separately isolated to purity from the large RNA fraction following HPLC using the Bio SEC-5 column (Agilent; 7.8 mm ...
-
bioRxiv - Immunology 2024Quote: ... Greyhound Chemicals), 10% LC-MS grade water (Ultra CHROMASOLV, Honeywell Riedel-de Haën) with 5 uM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Developmental Biology 2024Quote: Amplicons per sample were pooled to a maximum concentration of 5 ng/µl and assessed for DNA quality using a fragment analyzer (Agilent) and the Qubit™ dsDNA HS Assay kit (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... and 280 nm with a Eclipse Plus Phenyl-Hexyl column (250 mm length, 4.6 mm diameter, 5 μm particle size, Agilent Technologies). The flow rate was set to 0.5 mL/min for a 70/30 combination of the mobile phase in water and acetonitrile (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2023Quote: ... The sample (5 µl injection volume) was separated on a ZORBAX Eclipse Plus C18 (2.1×50 mm, 1.8 µm, Agilent Technologies, Inc.). Data analysis was performed with Agilent Profinder (v10.0 SP1 ...
-
bioRxiv - Physiology 2023Quote: HPLC separation was performed on an Agilent 1100 HPLC system using a 5 µm C18 column (4.6 mm × 150 mm, Agilent-XDB), maintained at 30°C ...
-
bioRxiv - Cell Biology 2024Quote: The fluorescence from mNG21-10/mNG211 complementation was visualized the day after transfection with the pH2B-mNG211 plasmid using a Cytation 5 microscope (Agilent) equipped with a 20x/0.45 NA phase contrast objective ...
-
bioRxiv - Biochemistry 2024Quote: ... The volatile components were separated by a DB-5 capillary column (30 m × 0.25 mm × 0.25 μm, Agilent, CA, USA) using high-purity helium as carrier gas with a 1.5 mL/min flow rate ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Bioengineering 2024Quote: ... Two-channel 85 µm z-stack images were taken using a Cytation 5 V3.14 cell imaging multi-mode reader (Agilent Technologies). A total of 21 z-stacks per well and per experiment were recorded and used for post-processing to calculate the cell phenotypic response in each hydrogel model.
-
bioRxiv - Microbiology 2023Quote: ... GC/MS analysis was performed on a Trace GC Ultra gas chromatograph with AS3000 Autosampler equipped with a Zorborbax DB-5 column (30 m, 0.25 mm i.d., 0.20 μm film thickness; Agilent J&W Scientific), with the eluate transferred at 280 °C to a Polaris Q mass spectrometer (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng of the protein extracts were run through a home-packed PLRP-S capillary column (200 mm long, 0.25 mm i.d., 5 μm particle size, 1000 Å pore size; Agilent Technology). The column was heated to 60 °C at an 8 μL/min flow rate ...
-
bioRxiv - Bioengineering 2023Quote: ... The luminescence signal which represents the amount of ATP in viable cells was measured with a microtiter well plate reader (BioTek Cytation 5, Agilent).
-
bioRxiv - Systems Biology 2023Quote: ... we used an Eclipse Plus Phenyl-Hexyl column (250 mm length, 4.6 mm diameter, 5 µm particle size, Agilent Technologies) and a Diode Array Detector (G4212 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were spun down 500 g for 5 min followed by sealing with optical clear permanent seal (Agilent, 24212-001) using the Plateloc Thermal Microplate Sealer (Agilent) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were centrifuged (20,000 x g for 10 min) and desalted using 5 uL C18 cartridges on the AssayMap BRAVO platform (Agilent Technologies). For each sample ...
-
bioRxiv - Biochemistry 2023Quote: ... 10μL of purified protein was injected to a C-18 column (Agilent Zorbax 300SB-C18, 5 μM, 2.1 x 150mm) without dilution or buffer exchange ...
-
bioRxiv - Microbiology 2023Quote: BAs in liver tissue and cecum content were extracted with methanol and 5 μL was injected onto a reverse-phased chromatography (1290 Infinity II, Agilent) and mass spectrometer (6546 Q-TOF/MS ...
-
bioRxiv - Biochemistry 2023Quote: ... The filtrate was injected into a C18 reversed-phase column (4.6 mm×150 mm, 5 μm particle size, Agilent, USA) in a Thermo-Fisher Ultimate 3000 separation module equipped with a DAD-3000 Diode Array Detector ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Five μL of analyte was applied to an Eclipse XDB-C18 column (150 x 4.6 mm, 5 μm, Agilent Technologies) and separated using the following gradient at 1 mL/min ...
-
bioRxiv - Biochemistry 2023Quote: ... Online HPLC was performed on a U3000 RSLC nano Pro-flow system using a C3 column (Zorbax 300SB-C3, 5 µm; Agilent). Samples were maintained at 4 °C and 1 µL injected for each analysis using a microliter pickup ...
-
bioRxiv - Cancer Biology 2023Quote: 250 M10M6-PtenC124S cells and 750 M10M6-PtenWT cells were seeded in 384 well plate with 40 µL RPMI-1640 medium containing 5% FBS using Bravo automated liquid handling platform (Agilent). After 24 hours ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 μg of TMT-labeled peptides were loaded onto 10 cm capillary columns packed with 5 μM Zorbax SB-C18 (Agilent), which was connected using a zero dead volume 1 μm filter (Upchurch ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were then transferred immediately into a 5 mm NMR tube (Wilmad) and placed into a 600 MHz magnet with a coldprobe (Agilent). The peptide backbone was assigned using a combination of BEST versions of 3D HNCA ...
-
bioRxiv - Microbiology 2023Quote: ... The optical density was measured at 540 nm and subtracted from readings at 450 nm using the BioTek Cytation 5 Cell Imaging Multimode Reader (Agilent). Concentrations were calculated from standard curves run in parallel.
-
bioRxiv - Systems Biology 2023Quote: ... the peptides were reconstituted in 10 mM TEAB and fractionated using a bRPLC column (Agilent 300 Extend-C18 column, 5 µm, 4.6 mm × 250 mm, Agilent Technologies) under an increasing gradient of the mobile phases consisting of 10 mM TEAB in water and 90% acetonitrile (ACN) ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Microbiology 2023Quote: ... Membrane fluidity was determined by using an excitation wavelength of 350 nm and measuring fluorescence at 460 nm and 500 nm emission wavelengths on a BioTek Cytation 5 Cell Imaging Multimode Reader (Agilent). The generalised polarisation (GP ...
-
bioRxiv - Microbiology 2023Quote: ... 200 μl were aliquoted into black 96 well plates in triplicate and fluorescence was measured using a BioTek Cytation 5 Cell Imaging Multimode Reader (Agilent). The excitation wavelength used was 488 nm and emission wavelength used was 530 nm.
-
bioRxiv - Molecular Biology 2023Quote: TEV eluates (about 650-700 µl) were partially digested for 5 min at 37 °C with 25 µl of RNase-IT (Agilent) diluted to 1:50 in TNM100 buffer and the reactions were stopped using 0.4 g guanidine hydrochloride ...
-
bioRxiv - Bioengineering 2023Quote: ... slides were counterstained with DAPI (1µg/ml) in PBS for 5 min followed by water washes and cover slipping with fluorescent antifade mounting reagent (DAKO, Agilent).
-
bioRxiv - Bioengineering 2023Quote: ... Peptides were loaded to a nanoscale HPLC column composed of 10 cm of Polaris C18 5 μm packing material (Agilent), followed by 4 cm of Partisphere 5 SCX (Whatman) ...
-
LRBA balances antigen presentation and T-cell responses via autophagy by binding to PIK3R4 and FYCO1bioRxiv - Immunology 2024Quote: ... cell nuclei were stained with DAPI for 5 min prior to mounting the cover slip onto a glass slide using DAKO mounting medium (Agilent). Cells were visualized through 63x ...
-
bioRxiv - Biochemistry 2024Quote: ... A Zorbax SB-C8 reversed-phase column (5 μm, 2.1 x 50 mm) was obtained from Agilent (Palo Alto, CA). The LC eluent was introduced into the ESI source of the mass spectrometer ...
-
bioRxiv - Neuroscience 2024Quote: ... sound stimuli consisted in single-cycle sound pips (5-ms duration at 200 Hz) produced by a function generator (33210A Agilent Technologies Inc. ...
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2024Quote: ... This construct was also used to generate the let-7 ʻseed’ deletion mutant derivative using the QuikChange Multi Site Mutagenesis Kit (catalog 200514-5, Stratagene). 3T3 mouse embryonic fibroblasts (MEFs ...
-
bioRxiv - Cell Biology 2024Quote: ... Mixtures were incubated at RT for 60 min in the dark and absorbance at OD570 was measured on a microplate reader (Bio Tek Cytation 5, Agilent). For each LD sample ...
-
bioRxiv - Genomics 2024Quote: ... each library underwent a reconditioning PCR to reduce heteroduplexes: libraries were concentrated down to 5 µl and mixed with 10 µl of Herculase Buffer (Agilent), 5 µl of 2.5 nM dNTPs ...
-
bioRxiv - Plant Biology 2024Quote: ... The plates were placed in either a BioTek Cytation 5 or Synergy HT plate reader (Agilent, Santa Clara, CA, USA) set at 22°C ...
-
bioRxiv - Cell Biology 2024Quote: ... The HPLC conditions employed two normal-phase Zorbax Sil (5 μm, 4.6 × 150 mm) columns (Agilent, Santa Clara, CA, USA), connected in series within the Multicolumn Thermostat compartment ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2,000 cells were seeded on a well of a 96-well plate and brightfield images were taken every two hours by using the BioTek BioSpa 8 Automated Incubator and Citation 5 reader (Agilent). BioTek Gen5 imaging software (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... We performed the HPLC with a normal phase Zobax Sil (5 μm, 4.6 × 150 mm) column (Agilent, Santa Clara, CA). Isocratic chromatographic separation was achieved with 10% ethyl acetate/hexane at a flow rate of 1.4 ml/min ...
-
bioRxiv - Immunology 2019Quote: ... Ms CFH-Santacruz, sc-166613, 1: 50, Rb CXCR4, sc-9036, 1:50, Rb CD11b, CST,49420, 1:200, Rb GFAP, Dako, Z0334). After washing thrice with 1x PBS and the sections were incubated with appropriate fluorescent labelled secondary antibodies (Goat anti Rb594,Life Tech ...
-
bioRxiv - Microbiology 2022Quote: ... For visualising HSV-1 plaques mouse anti-gD (LP2) 1:50 [75] and HRP-conjugated rabbit anti-mouse 1:5000 (DaKo, P0161) were used.
-
bioRxiv - Neuroscience 2023Quote: Primary antibodies to the following proteins were used at the indicated concentrations: ubiquitin (1:1000, P4G7, BioLegend; 1:200 Cell Signaling; 1:200, Z0458, Dako), GABARAP (1:1,000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies (Supplementary Table 2) were diluted according to manufacturer’s guidelines in DAKO Antibody Diluent (cat. S202230, Agilent). Cells were incubated with the primary antibody mixes overnight at 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Both the trap (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and the analytical (Agilent Poroshell EC-C18 ...
-
bioRxiv - Microbiology 2021Quote: ... we generated a pT7-D6/2-NSP1-null via the QuikChange II site-directed mutagenesis kit (Agilent Technology) based on pT7-D6/2-NSP1 (22) ...