Labshake search
Citations for Agilent :
101 - 150 of 1340 citations for mmu mir 378c RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... All the mutagenesis primers were designed using QuikChange Primer Design Program (Agilent) and are listed in Supplementary Table 5a ...
-
bioRxiv - Molecular Biology 2022Quote: ... and random primers (Agilent) and a volume of cDNA corresponding to 5 ng of the input RNA was subjected to 30 cycles of PCR with the 2 x NEBNext Ultra II Q5 Master Mix (NEB).
-
bioRxiv - Developmental Biology 2022Quote: ... 1.2μL each of forward and reverse primer along with 0.6μL of PCR water and 5μL Brilliant Sybr Green III qPCR master mix (Agilent Technologies; Cat# 600882). qPCR was carried out at CFX96 Touch System (Bio-Rad ...
-
bioRxiv - Genomics 2019Quote: ... a double-stranded DNA probe (obtained by PCR amplification using oligonucleotides AMO2002-2003) was 32P-labelled using the Prime-It II Random Primer Labeling Kit (Agilent), then hybridized overnight at 65°C in PerfectHyb™ Plus Hybridization Buffer (Sigma).
-
bioRxiv - Neuroscience 2021Quote: ... Both Southern blot probes were generated by standard PCR and subjected to random labelling using a Prime-It II Random Primer Labelling Kit (#300385, Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Phosphorylation site mutations and gRNA sequences were introduced into vectors by PCR amplification with mutagenic primers (Table 3) with Phusion (Thermo) or PfuUltra II (Stratagene) polymerase ...
-
bioRxiv - Microbiology 2022Quote: ... a pool of sgRNA-encoding inserts was generated by PCR amplification with primers oJMP697 and oJMP698 from a 78-nt custom oligonucleotide library (2020-OL-J, Agilent) with the following conditions per 500 µl reaction ...
-
bioRxiv - Microbiology 2023Quote: ... This DNA was then subject to an initial round of PCR amplification with primers oTB535 and oTB536 with the Easy A cloning kit (Agilent), digested with NotI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... The samples quantity and purity were determined using a NanoDrop spectrophotometer while the 4C PCR library efficiency and the absence of primer dimers were reconfirmed by Agilent Bioanalyzer ...
-
bioRxiv - Systems Biology 2023Quote: ... a pool of sgRNA-encoding inserts was generated by PCR amplification with primers oJMP697 and oJMP698 from a 78-nt custom oligonucleotide library (2020-OL-J, Agilent) with the following conditions per 500 µl reaction ...
-
bioRxiv - Cancer Biology 2023Quote: ... The purified capture products was then amplified using the SureSelect Post-Capture Indexing forward and Index PCR reverse primers (Agilent) for 12 cycles ...
-
bioRxiv - Biophysics 2023Quote: ... The His-TEV-mRaichu coding sequence was amplified by PCR using the primers GACGAATTCATGAATCACAAAGTGCATCAT and CTCGACAAGCTTTTAGATTCTGTGCTTTTAAGC and was inserted into the SmaI site of pBCKS (Stratagene). The coding sequence in the resultant plasmid was subcloned into the pFastBac™ Dual Expression Vector (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was amplified by PCR using the primers with Herculase II Fusion DNA polymerase (Agilent Technologies, Santa Clara, CA, USA). PCR products were separated by electrophoresis through a 2% agarose gel in 1× TBE and stained with GelRed (Biotium ...
-
bioRxiv - Plant Biology 2024Quote: ... Quantitative real-time PCR was performed with primers (Table S2) and Brilliant Sybr Green QPCR Reagent Kit (Stratagene, Waldbronn, Germany). The ratio of G ...
-
bioRxiv - Microbiology 2022Quote: ... This pair of primers was designed using the QuickChange Primer Design tool (Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Mutagenesis primers were designed using the QuikChange Primer Design web-based tool (Agilent) and purchased from Integrated DNA Technologies (Supplemental Table 1) ...
-
bioRxiv - Microbiology 2021Quote: ... and generic real-time reverse-transcription PCR (RT-qPCR) as previously published (29) in AriaMx real-time cycler (Agilent, Germany). Standard curves generated by serial dilutions of B_NS217 (10 to 100000 pfu ...
-
bioRxiv - Plant Biology 2020Quote: Quantitative RT-PCR quantification was conducted using the standard curve method as described in the Methods and Applications Guide from Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: Qualitative and quantitative measurements of viral load were determined by quantitative RT-PCR,10 ul of RNA combined with 25 ng Human Universal Reference RNA (Agilent) was purified by PureBeads (Roche Sequencing) ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT-PCR data was analyzed and visualized for pathway analysis by GeneSpring GX 14.9 (Agilent Technologies, Santa Clara, CA, USA) and by Enrichr (Icahn School of Medicine ...
-
bioRxiv - Genetics 2020Quote: Quantitative RT-PCR was performed on MYB5a and MYB5b using SYBR-Green Brilliant III Ultra-Fast reagents (Agilent Technologies, USA), in optical 96-well plates (Greiner Bio-One ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative RT-PCR quantification was conducted using the standard curve method as described in the Methods and Applications Guide from Agilent Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... and all RT-qPCR reactions were performed on an AriaMx Real-Time PCR System instrument (Agilent Technologies Santa Clara, California). Thermal cycling conditions were as follows:
-
bioRxiv - Biophysics 2021Quote: ... Site-directed mutagenesis was performed using custom-designed primers (Eurofins Genomics) and regular PCR with PfuUltra II Fusion HS DNA Polymerase (Agilent Technologies). Plasmids were linearized using EcoRI (for mASIC1a ...
-
bioRxiv - Plant Biology 2019Quote: ... 300 nM each primer, Taq DNA Polymerase (Genbiotech, Argentina) and EvaGreen™ as dye in AriaMx Real Time PCR System (Agilent). MiRNA levels were determined by stem-loop qPCR[41] ...
-
TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancerbioRxiv - Cancer Biology 2023Quote: ... Primers containing the appropriate mutations were designed with QuickChange® Primer Design Program (Agilent). All primers (Appendix Table S1 ...
-
bioRxiv - Biochemistry 2023Quote: ... Universal reverse primers (Agilent Technologies) and unique miR-specific primers (same sequence as an analyzed miR ...
-
bioRxiv - Genetics 2019Quote: ... Approximately 500 pg of cDNA were utilized to measure the relative expression level of target genes through quantitative real-time PCR (RT-qPCR) using the Brilliant III ultra-fast SYBR green QPCR mix (Agilent Technologies) in an Applied Biosystems 7500 Real-Time PCR System ...
-
bioRxiv - Microbiology 2019Quote: ... Approximately 500 pg of cDNA were used to measure the relative expression level of target genes through quantitative real-time PCR (RT-qPCR) using the Brilliant III ultra-fast SYBR green QPCR mix (Agilent Technologies) in an Applied Biosystems 7500 Real-Time PCR System ...
-
bioRxiv - Microbiology 2021Quote: ... The total volume for the RT-PCR reaction was 50 μl using a High-Fidelity DNA Polymerase (Agilent, Santa Clara, USA), with MBtuni-12 and MBtuni-13 (5’-ACG CGT GAT CAG TAG AAA CAA GG-3’ ...
-
bioRxiv - Pathology 2020Quote: ... and real-time RT-PCR was performed using Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies, CA, USA). The synthetic gene-specific primers are listed in Table 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: Evolved viral genomes of the passage 12 from each lineage and genotype were amplified by high-fidelity RT-PCR using the AccuScript Hi-Fi (Agilent Technologies) reverse transcriptase and Phusion DNA polymerase (Thermo Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... Grown colonies were screened with colony PCR using CP-F and UnivR primers and KAPA2G Robust HotStart Kit (Agilent, Supplemental Method 2). Sanger sequencing of the selected clone confirmed correct sequence of the PVY-coding part and correct in-frame insertion of GFP coding sequence ...
-
bioRxiv - Microbiology 2020Quote: ... Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies, Santa Clara, CA). The upper limit of annealing temperature was set at 65 °C and the lower limit at 53 °C ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... Probes produced from PCR templates were radiolabelled with [α-32P]-dCTP (Hartmann Analytic, #SRP-305) using Prime-it II Random Primer Labelling kit (Agilent, #300385) and oligonucleotides used as a probe were radiolabelled with [γ-32P]-ATP (Hartmann analytic #SRP-501) ...
-
bioRxiv - Plant Biology 2019Quote: ... Primers of different point mutants were designed by online tool QuikChange Primer Design (Agilent Technologies). All primers used for this experiment are listed in Table 1.
-
bioRxiv - Microbiology 2019Quote: ... Primers used for site-directed mutagenesis were designed using the primer design tool from Agilent technologies.
-
bioRxiv - Microbiology 2019Quote: ... containing the Yeast V2 probe-set (Agilent ID: 016322) together with 39 probes corresponding to Saccharomyces cerevisiae EC1118 specific genes [13] ...
-
bioRxiv - Genomics 2020Quote: ... Probe sets used for FISH were designed by Agilent technologies using their standard procedures against genomic regions defined in Table S12 ...
-
bioRxiv - Genomics 2022Quote: ... The final set of probes was ordered from Agilent. To validate the coverage across a reference F ...
-
bioRxiv - Immunology 2020Quote: mRNA in total RNA was converted to cDNAby using AffinityScript One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, CA, USA) following the method described elsewhere (17) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Site directed mutagenesis was performed using primers designed using the QuikChange Primer Design tool by Agilent Technologies with QuickChange® II Kit settings (https://www.agilent.com/store/primerDesignProgram.jsp).
-
bioRxiv - Biochemistry 2023Quote: ... enterica WbaP Cys-pair variants were generated using primers designed in the quikchange primer tool (Agilent). Successful mutations were confirmed by Sanger sequencing ...
-
bioRxiv - Biochemistry 2022Quote: Fusion constructs and large deletions were generated by overhang extension PCR [79] using primers from IDT (IDT, Coralville, IA) and cloned Pfu DNA polymerase (Stratagene, La Jolla, CA). Point mutations and small deletions or insertions were generated using QuickChange [80] with Turbo Pfu DNA polymerase (Stratagene ...
-
bioRxiv - Pathology 2020Quote: ... beads were collected for 2 min on a magnet and then resuspended in 25 µL PCR master mix containing PCR1 primers and Herculase-II (Agilent, Santa Clara CA). PCR cycling was as follows ...
-
bioRxiv - Cell Biology 2020Quote: Adenoviruses for miR-29a and the scrambled miRNA control were cloned using the AdEasy system (Agilent, Cat#240010) according to the protocol provided ...
-
bioRxiv - Genetics 2023Quote: ... Primers with the alternate alleles for each SNP were designed using the “QuikChange Primer Design” (Agilent technologies) platform ...
-
bioRxiv - Immunology 2021Quote: cDNA was synthesized from the previously extracted RNA of mice colon tissue by using Affinity Script One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, CA, USA). RNA was mixed with random 9mer primers ...
-
bioRxiv - Genomics 2021Quote: ... 0.4 μL universal reverse primer (Agilent Technologies), 100 ng cDNA and H2O up to 10 μL was made for each sample ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-K-RasG12V H95C and GFP-H-RasG12V Q95H mutants were designed and ordered from Agilent QuikChange Primer Design (Agilent; Santa Clara, CA). cDNA of H-RasG12V Q95H ...