Labshake search
Citations for Agilent :
351 - 400 of 1340 citations for mmu mir 378c RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... the PCR was performed in triplicate per ligation reaction using the Herculase II PCR reagents (Agilent Technologies, 600677). The parallel library preparations and PCR reactions were subsequently pooled for each reaction.
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR analysis was performed with SYBR Premix Ex Taq II on AriaMx Real-time PCR system (Agilent). Specific primer sets for age-related genes and housekeeping gene were used ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative PCR was performed using PerfeCTa SYBR Green Fastmix (Quantabio) on a AriaMx Real-time PCR System (Agilent, US under the following conditions ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR was performed using the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent, 600886) on a Mx3005P Real-Time PCR System (Agilent) ...
-
bioRxiv - Cell Biology 2019Quote: ... iv) the 4xNLS sequence was removed with the primers DPD695 and DPD696 using QuikChange Site-Directed Mutagenesis (Agilent) to generate pDD111 - Pegl-1::mCherry::PH::unc-54 3’UTR.
-
bioRxiv - Microbiology 2021Quote: ... plasmid was reacted with primer pairs designed to introduce the desired mutations using Quikchange kit (Agilent, cat# 600670). After digestion with the restriction enzyme DpnI (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... The mutants were created by the same method for site-directed mutagenesis using specific primers designed from Agilent QuickChange Primer design web tool ...
-
bioRxiv - Pathology 2021Quote: ... The promoter DNA was amplified with primers containing Nhe1 and Xho1 sites using Pfu Ultra II polymerase (Agilent) to generate the 0.7 kb truncated form in the pGL3-basic vector ...
-
bioRxiv - Microbiology 2020Quote: ... the primer pair dsbS(H235A)-F/R and a QuikChange II site-directed mutagenesis kit (Stratagene, catalog#:200518) were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... Quick-change Site-Directed Mutagenesis was conducted using primers listed in Table S4 using the Quick-change (Agilent) or Q5-Site-directed mutagenesis kit (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... The DNA probes were labeled with [α-32P] dCTP by Prime-It II Random Primer Labeling Kit (Stratagene) as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA probes were labeled with 32P using the Prime-It II Random Primer Labeling Kit (Agilent Cat. #300385). The Syngap1 probe corresponds to NM_001281491 nucleotides 1361- 2002 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we preformed PCR using PFUultra II (Agilent), the primers F1 and R3 5’gaggtgggcagtcatccatc3’ ...
-
bioRxiv - Cancer Biology 2021Quote: ... and AriaMx Real-Time PCR System (Agilent). Relative gene expression was normalized to internal control genes ...
-
bioRxiv - Plant Biology 2021Quote: ... in real time PCR (Agilent Technologies, USA) detection system ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using Herculase II (Agilent) or Q5 High-fidelity DNA Polymerase (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... The AriaMX real-time PCR system (Agilent) served for thermal cycling of the duplicate samples with the recommended conditions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... qRT-PCR was performed by MX3000P(Agilent) using UltraSYBR Mixture (Low ROX ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was performed using AriaMX (Agilent) with 12.5 μl of either Power SYBR Green master mix or Taqman master mix (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... and AriaMx Real-time PCR Systems (Agilent). TBEV forward primer (5’-3’ GGGCGGTTCTTGTTCTCC) ...
-
bioRxiv - Biochemistry 2021Quote: ... For PCR mutagenesis PFU Ultra Polymerase (Stratagene) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... A Real-Time PCR Mx3005p machine (Stratagene) was used to record fluorescence ...
-
bioRxiv - Biophysics 2023Quote: ... PCR site directed mutagenesis kit (Agilent Technologies) was used according to the instruction manual for mutagenesis PCR.
-
bioRxiv - Neuroscience 2023Quote: ... PCR products were confirmed by Tapestation (Agilent), and cleaned up with ExoSAP-IT (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... on AriaMx qRT-PCR system (Agilent Technologies). The following primers were used ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Purity and integrity of the RNA was assessed on the Agilent 2100 Bioanalyzer with the RNA 6000 Pico LabChip reagent set (Agilent, Palo Alto, CA, USA).
-
bioRxiv - Genomics 2021Quote: ... Libraries from all sample sets were quantified on the 2100 Bioanalyzer instrument with the Agilent DNA 7500 Kit (both Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Immunology 2020Quote: ... Purity and integrity of the RNA was assessed on the Agilent 2100 Bioanalyzer with the RNA 6000 Pico LabChip reagent set (Agilent, Palo Alto, CA, USA). The SMARTer Ultra Low Input RNA Kit for Sequencing v4 (Clontech Laboratories ...
-
bioRxiv - Physiology 2023Quote: ... in 10X magnification in non-confocal mode with DAPI filter set (ex.405/em.455nm) and FITC filter set (ex.488/em.525nm) on the automated high content screening platform (Agilent Technologies, Santa Clara, USA) (Equipex Imaginex Biomed ...
-
bioRxiv - Neuroscience 2024Quote: ... Purity and integrity of the RNA was assessed on the Agilent 2100 Bioanalyzer with the RNA 6000 Pico LabChip reagent set (Agilent, Palo Alto, CA, USA).
-
bioRxiv - Cell Biology 2020Quote: ... The PCR products of positive clones were then cloned into competent cells using the StrataClone PCR Cloning Kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR amplification was carried out using the Paq5000 Hotstart PCR Master Mix following the manufacturer’s protocol (Agilent, USA). Cycling was performed on an Applied Biosystems Thermal Cycler with cycles consisting of an initial denaturation step at 95°C for 2 min ...
-
bioRxiv - Microbiology 2022Quote: ... The quantitative PCR was performed using the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent, 600886) on a Mx3005P Real-Time PCR System (Agilent) ...
-
bioRxiv - Biochemistry 2023Quote: ... The resulting PCR products were subcloned into the holding vector pSC-B (StrataClone Blunt PCR Cloning Kit, Agilent Technologies) and 16 colonies (white ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR amplicons were further cloned into a pSC-amp/kan vector using StrataClone PCR cloning kit (240205, Agilent Technologies). We picked ∼20-50 single colonies per sample to determine the presence ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative PCR was performed using the 1-Step Brilliant II SYBR Green QRT-PCR Master Mix kit (Agilent Technologies) and the TaqPath 1-Step Multiplex Master Mix kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... Final library quality control consisted of confirmation of amplification and barcoding by SYBR Green-based RT-qPCR (Stratagene Mx3005P QPCR System ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The RT-qPCR was carried out using Brilliant III Ultra-fast SYBR green qPCR master mix (Agilent Technologies), on a AriaMx Real-time PCR system (Agilent Technologies ...
-
bioRxiv - Genomics 2021Quote: ... RT-qPCR was undertaken following the Brilliant III Ultra Fast SYBR QPCR Master Mix protocol (Agilent Technologies, 600882) and results were analysed with MxPro v4.10 ...
-
bioRxiv - Neuroscience 2022Quote: ... membranes were incubated for 1h at RT with the secondary antibody (Polyclonal Goat Anti-Rabbit Immunoglobulins/HRP, Dako; Polyclonal Goat Anti-Mouse Immunoglobulins/HRP ...
-
bioRxiv - Developmental Biology 2024Quote: ... slides were counterstained with DAPI for 1 min at RT and mounted with Fluorescence Mounting Medium (S3023; Dako). Fluorescence was observed with a SP8-DLS confocal microscope (Leica Microsystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... diluted in PBS for 10 min at RT and accordingly mounted using DAKO fluorescent mounting medium (DAKO; S3023). Zeiss Axio Imager Z1 was used to image the samples ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA was processed for reverse transcription (RT) using AccuScript High-Fidelity First Strand cDNA Synthesis Kit (Agilent). A mix of anchored-Oligo(dT ...
-
bioRxiv - Plant Biology 2021Quote: ... a site-directed mutagenesis using primers CRIB157H37&40Y_for and CRIB157H37&40Y_rev was performed according to QuikChange® Site-Directed Mutaganesis Protocol (Stratagene). For cloning entry constructs of RACB variants ...
-
bioRxiv - Biochemistry 2020Quote: ... The LaGH13_31B Y295A variant was generated using primers in Table S3 and the QuickChange II Site-Directed Mutagenesis kit (Agilent) with pET-28a(+)-LaGH13_31B as template ...
-
bioRxiv - Neuroscience 2020Quote: ... was generated by site directed mutagenesis using primers oM18_17 and oM18_18 (Table 1) and a Quikchange II Site-directed Mutagenesis kit (Agilent, 200523). The PCR product was digested with DpnI enzyme to remove template vector and transformed into Stbl2 chemically competent cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... Storz and pRprAmut2 was constructed by amplification of the pRprA plasmid with mutagenic primers using the Pfu enzyme (Agilent), followed by DpnI digestion and transformation into the cloning strain NEB5-alpha F’Iq ...
-
bioRxiv - Neuroscience 2022Quote: ... The N100A zDHHC/A17 mutants were generated by our laboratory by site-directed mutagenesis using primers designed by Agilent QuickChange II XL primer design software and using QuickChange II XL site-directed mutagenesis kit (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Synthesis of cDNA was carried out using the AffinityScript qPCR cDNA Synthesis Kit and random primers (Agilent Technologies, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Pathology 2021Quote: ... The region containing random fragments of the VWF plasmid was made double stranded using primers P9/P10 (annealing temperature = 65.0°C) and Herculase II (Agilent) with 16-20 rounds of PCR amplification (Figure S1B) ...