Labshake search
Citations for Agilent :
101 - 150 of 1478 citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Molecular Biology 2024Quote: Serial sections of human and mouse FFPE BM biopsies were prepared at 3-5 μm thickness on coated microscope slides (Dako FLEX, Agilent) and processed for immunohistochemistry/immunofluorescent-based (IHC-IF) ...
-
bioRxiv - Biochemistry 2024Quote: ... were kept in a 5°C autosampler prior to analysis and injected onto a reverse- phase Zorbax SB-C18 column (150×3 mm, 5 μm particle size, Agilent, Santa Clara ...
-
bioRxiv - Cancer Biology 2022Quote: ... and fixed with precooled methyl alcohol in −20℃ for 30 min followed by H&E staining (Eosin, Dako CS701 ...
-
bioRxiv - Synthetic Biology 2021Quote: All CoA esters were measured on a triple quadrupole mass spectrometer (Agilent Technologies 6495 Triple Quad LC/MS) equipped with a UHPLC (Agilent Technologies 1290 Infinity II ...
-
bioRxiv - Developmental Biology 2020Quote: ... antibody staining was carried out using an anti-RFP antibody for 1h detected with EnVision HRP anti-rabbit secondary (Agilent) followed by incubation with Tyramide-conjugated Opal 570 (PerkinElmer ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were rinsed and incubated with biotinylated rabbit anti-rat IgG for 1h (1:200, DAKO Cytomation A/S, Denmark). Following avidin-biotin-peroxidase complex (Vector laboratories ...
-
Treatment with furosemide indirectly increases inhibitory transmission in the developing hippocampusbioRxiv - Neuroscience 2023Quote: ... The membrane was washed 3 times 15 minutes with TBST before a 1h incubation of horseradish peroxidase (HRP)-conjugated antibodies (P0447 goat anti-mouse IgG HRP, Dako, 1:2500 or P0399 swine anti-rabbit IgG HRP ...
-
bioRxiv - Neuroscience 2023Quote: ... The membrane was washed 3 times 15 minutes with TBST before a 1h incubation of horseradish peroxidase (HRP)-conjugated antibodies (P0447 goat anti-mouse IgG HRP, Dako, 1:2500 or P0399 swine anti-rabbit IgG HRP ...
-
bioRxiv - Molecular Biology 2020Quote: ... Library quality was confirmed by Agilent 2200 TapeStation nucleic acids system (Agilent) using the Agilent High Sensitivity D1000 DS DNA kit ...
-
bioRxiv - Molecular Biology 2020Quote: ... Library quality was confirmed by Agilent 2200 TapeStation nucleic acid system (Agilent) using the Agilent High Sensitivity D1000 DS DNA kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Medronic acid was purchased from Agilent Technologies (Santa Clara).
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Genomics 2022Quote: ... The bisulfite-converted library was PCR amplified and indexed using the SureSelect XT Mouse Methyl-Seq Kit (Agilent, #G9651A). Prepared libraries were run on an Illumina sequencing platform using a NextSeq High 150 bp paired-end mode.
-
bioRxiv - Immunology 2024Quote: ... 15 mM acetic acid and 2.5 µM medronic acid (5191–4506, Agilent Technologies, Santa Clara, CA, USA). The LC gradient was ...
-
bioRxiv - Biochemistry 2023Quote: ... blots were incubated for 1h at room temperature with a horse radish peroxidase-labeled secondary antibody (anti-rabbit, Dako; 1/1000), and revealed by ECL chemiluminescence (Millipore ...
-
bioRxiv - Cell Biology 2022Quote: ... and its purity and identity was confirmed by 1H NMR (Varian Mercury Plus 300 MHz) and LCMS-ELSD (Agilent 6530 QTOF). For each experiment ...
-
bioRxiv - Cancer Biology 2024Quote: All 2D 1H J-resolved (JRES) NMR spectra were acquired on a 500LMHz VNMRS Varian/Agilent spectrometer (Agilent, Santa Clara, CA) at 25L°C using a double spin echo sequence with pre-saturation for water suppression and 16 transients per increment for a total of 32 increments ...
-
bioRxiv - Bioengineering 2024Quote: ... and reverse primer (5’-AGGTCATGTACTGGGCATAAT-3’) binding to the GFP sequence with 5 µL of Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies, USA) and 0.15 µL of 2 µM reference dye.
-
bioRxiv - Molecular Biology 2024Quote: Serial sections of human and mouse FFPE BM biopsies were prepared at 3-5 μm thickness on coated microscope slides (Dako FLEX, Agilent) and processed for immunohistochemistry/immunofluorescent-based (IHC-IF) ...
-
bioRxiv - Biochemistry 2024Quote: ... These samples were desalted using preequilibrated (3x 15 µL of 50% ACN 0.2% Formic acid then 3X 15 µL 0.2% formic acid) Cleanup C18 pipette tips (Agilent) by pipetting 15 µL of the acidified solution 10X to ensure full binding of the peptides to the C18 plug in the tips ...
-
bioRxiv - Genomics 2020Quote: ... The library preparations for the genome-wide data were performed according to the SureSelect XT Mouse Methyl-Seq Kit Enrichment System for Illumina Multiplexed Sequencing Library protocol (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: - Medronic acid (Cat# 5191-3940, Agilent Technologies)
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen-antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with hematoxylin (Dako ...
-
bioRxiv - Physiology 2022Quote: ... Antigen–antibody complexes were revealed with 3-3′- diaminobenzidine (K346811, Dako) or the DAB (Polymer ...
-
bioRxiv - Cell Biology 2024Quote: ... at 1:500 and 3-3’-diamino-benzidine-tetrahydrochloride (Dako, K3468). Stained sections were imaged using an NanoZoomer 2.0HT (Hamamatsu).
-
bioRxiv - Cancer Biology 2024Quote: ... Antigen–antibody complexes were reveled with 3-3′-diaminobenzidine (K346811, Agilent). Sections were counterstained with hematoxylin (CS700 ...
-
bioRxiv - Neuroscience 2021Quote: All MRI and 1H MRS data were acquired in a 9.4 T Varian Direct Drive system (Agilent Technologies, Santa Clara, CA, USA). A 14 mm diameter receive-only surface RF coil (Doty Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... esters and 4-vinyl guaiacol concentrations were analysed using headspace solid phase micro-extraction coupled with gas chromatography (Agilent 7890A)- mass spectrometry (Agilent 5975C ...
-
bioRxiv - Biochemistry 2024Quote: ... a Personal Compound Database Library (PCDL) exclusively containing cholesterol and cholesteryl esters was curated using MassHunter PCDL manager B.08.00 (Agilent Technologies). The data files were processed in Agilent MassHunter Qualitative Analysis 10.0 using this PCDL library ...
-
bioRxiv - Microbiology 2024Quote: ... ethyl methyl sulfide] of 20 µL were pipetted into a 20 mL HS vial sealed by a metal screwcap with a PTFE/silicone septa for quantitation of higher alcohols and esters by Agilent GC 7890B coupled with a PAL autosampler (RSI 85 ...
-
bioRxiv - Physiology 2023Quote: ... Hepatic portal vein bile acids and short chain fatty acids were acquired using an Agilent 1290 series HPLC (Agilent,) with an Acquity C18 BEH (2.1mm x 50mm ...
-
bioRxiv - Genomics 2022Quote: ... the SureSelect XT Mouse Methyl-Seq Kit Enrichment System for Illumina Multiplexed Sequencing Library protocol (Agilent Technologies, version E0, April 2018) was used as described before (34) ...
-
bioRxiv - Microbiology 2021Quote: ... Tissue sections were colored via DAB-staining (3, 3-diaminobenzidine; Dako, K3468).
-
bioRxiv - Evolutionary Biology 2020Quote: ... or with minor N-terminal truncations to exclude the transmembrane regions (Sphaeroforma arctica: amino acids 21-316; Auxenochlorella protothecoides: amino acids 21-327) in Arctic Express DE competent cells (Agilent). At the N-terminus ...
-
bioRxiv - Bioengineering 2024Quote: ... The amino acids were derivatized with OPA for primary amino acids and FMOC for secondary amino acids as per the protocol provided by Agilent. Derivatization was performed on the autosampler ...
-
bioRxiv - Microbiology 2022Quote: ... DirectDrive2 spectrometer operating at a 1H frequency of 600 MHz and using a 3.2-mm T3 HXY Magic Angle Spinning (MAS) probe (Agilent Technologies, Santa Clara, CA). These data were acquired on 34.1 and 39.7 mg ...
-
bioRxiv - Biophysics 2020Quote: ... instrument operating at a 1H frequency of 600 MHz and equipped with a 3.2-mm T3 HXY MAS probe (Agilent Technologies, Santa Clara, CA). All data were acquired on ~12-18 mg of lyophilized melanin ghost or whole cell samples using a Magic Angle Spinning (MAS ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated for 1h at RT before overnight incubation at 4°C with primary antibodies: Glial Fibrillary Acidic Protein (GFAP) (1/500 Dako Cat. Number Z0334); AQP4 (1/500 ...