Labshake search
Citations for Agilent :
101 - 150 of 815 citations for 4 Hydroxy 7 trifluoromethyl quinoline 3 carbohydrazide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Microbiology 2020Quote: ... Sections were incubated with primary antibodies for cytokeratin 7 (CK7; OV-TL 12/30,DAKO,Ready-to-Use), 3-mercaptopyruvate sulfurtransferase (MPST ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was quantified by Qubit Fluorometer 2.0 and RNA integrity was confirmed (RIN >7) by 2100 Bioanalyzer (Agilent). Amplified cDNA libraries were constructed using SMART-seq v4 Ultra low Input RNA-kit (Takara ...
-
bioRxiv - Genomics 2021Quote: ... RNA was quantified by Qubit Fluorometer 2.0 and RNA integrity was confirmed (RIN >7) by 2100 Bioanalyzer (Agilent). RNA was amplified using NuGen Ovation RNA amplification kit and sheared to an average size of 200 bp ...
-
bioRxiv - Cancer Biology 2020Quote: ... Strand specific RNA sequencing was performed on quality controlled high RIN value (>7) RNA samples (Bioanalyzer Agilent Technologies). In brief ...
-
bioRxiv - Microbiology 2024Quote: ... Foci were manually counted from images obtained on Cytation 7 plate reader (Agilent Life Sciences, Santa Clara, CA). For mosquito infectivity ...
-
bioRxiv - Cancer Biology 2022Quote: ... in a citrate buffer for 20 min at 95°C for TP53 (1:800, Dako, M7001 DO-7), BCL-10 (1:1000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Only samples with RNA integrity number >7 as measured using a Bioanalyzer 2100 with RNA 6000 Nanochips (Agilent) were sequenced.
-
bioRxiv - Microbiology 2024Quote: ... The integrity of RNAs (RIN>7) was verified by the Agilent Bioanalyzer RNA NanoChips (Agilent technologies, Wilmington, DE).
-
bioRxiv - Immunology 2024Quote: ... either in a 96-well round-bottom plate (Sections 2.5-7, 2.10) or a Seahorse XFe96 cell culture microplate (Agilent Technologies ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 mL capacity (Agilent Cat. #: 5185-5991) and centrifuged at 17,172 × g for 45 min at 4 °C ...
-
The integrated stress response promotes macrophage inflammation and migration in autoimmune diabetesbioRxiv - Immunology 2024Quote: ... and anti-insulin (Dako; IR002; 1:4) antibodies ...
-
bioRxiv - Cancer Biology 2024Quote: ... (4) CD68 (Macrophages, 1:400, M0876; Dako)–Opal 620 ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Developmental Biology 2021Quote: ... at a density of 7 x 105 cells per cm2 in Seahorse XF DMEM (Agilent cat. no. 103575-100) supplemented with 10mM glucose (Agilent cat ...
-
bioRxiv - Biophysics 2023Quote: ... 104 and 140) cDNA in pET-7 vector was modified by site directed mutagenesis (QuikChange Lightning kit; Agilent Technologies) to introduce one of four single cysteine mutants (T26C ...
-
bioRxiv - Developmental Biology 2023Quote: ... the beads were transferred into a 1-mL PP filtration microplate (Agilent, 7 µm frit, cat. no. 202501-100) and washed 3x with 200 µL 1x PBS and 2x 200 µL ultrapure water ...
-
bioRxiv - Physiology 2023Quote: ... RNA concentration and integrity (RIN>7 for all samples) was assessed via Qubit fluorometric quantitation and tapestation bioanalyzer (Agilent), respectively ...
-
bioRxiv - Microbiology 2024Quote: ... The samples containing an RNA integrity number (RIN) ≥ 7 were checked using the Agilent Bioanalyzer 2100 (Agilent Technologies, USA) and considered qualified for library preparation ...
-
bioRxiv - Molecular Biology 2024Quote: ... Each input was amplified and sequenced from three independent PCRs [7 cycles each using Taq Precision Plus (Agilent Technologies)] ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA quality was assessed by NanoDrop ND-1000 (260/280 >2; ThermoScientific) and by RNA ScreenTape (RIN ≥7; Agilent). Samples were then sent to the TCAG Microarray Facility at Sick Kids Hospital (Toronto ...
-
bioRxiv - Biophysics 2024Quote: The α-Syn WT containing plasmid pT7-7 was mutagenized using the QuickChange II site-directed mutagenesis protocol (Agilent). The primers used for the mutagenesis can be found in Table S1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the chambers were left to dry before imaging with Axio Observer.Z1/7 (Zeiss) or the BioTek Cytation 1 (Agilent).
-
bioRxiv - Biophysics 2024Quote: ... The measurements were acquired for 24 hours at 7-minute intervals in a microplate reader (Agilent BioTek Synergy H1) at 298 K ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... (3) CD8 (Cytotoxic T Cells, 1:400, M7103; Dako)–Opal 570 ...
-
bioRxiv - Genomics 2022Quote: ... we established an automated 3’UTR-seq (QuantSeq 3’mRNA-seq; Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Biophysics 2024Quote: ... Fluorescence measurements were carried out using 3×3 mm quartz cuvettes (Hellma Analytics, LineaLab, Badalona, Spain) in a Cary Eclipse spectrofluorimeter (Agilent Technologies, Madrid, Spain). Blanks in the absence of protein were routinely measured and subtracted ...
-
bioRxiv - Cancer Biology 2021Quote: Immunohistochemical staining of formalin-fixed, paraffin-embedded xenografts was performed after antigen retrieval (120°C, 7 min at pH9) and peroxidase blocking (Dako) using the UltraVision LP detection system (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Metabolites were analyzed on an Agilent 7890/5975C GC-MS using selected-ion monitoring methods described in previous work.7–10 Peaks were manually integrated using MSD ChemStation software (Agilent), and correction for natural isotope abundance was performed using the software Isocor (Millard et al. ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... All liver RNA samples had integrity numbers (RIN) ≥ 7 as verified with the Agilent 2100 Bioanalyser (Agilent Technologies, Waldbronn, Germany). A260/A280 were ≥ 1.8 as verified with Thermo Scientific™ NanoDrop 2000 spectrophotometer (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... sample input was 400 ng total RNA (determined by Qubit RNA HS reagents, Thermo) with RIN >7 (Bioanalyzer RNA Nano, Agilent). Libraries were prepared with the Biomek 400 Automated Workstation (Beckman Coulter) ...
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Cell Biology 2021Quote: ... and were mutated by deleting 6-7 base pairs using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). The primers used for mutagenesis are listed in Supplementary Table S6 ...