Labshake search
Citations for Agilent :
1 - 50 of 815 citations for 4 Hydroxy 7 trifluoromethyl quinoline 3 carbohydrazide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... the AFC (7-amino-4-trifluoromethyl coumarin) fluorescent signals were measured on a Cytation 5 instrument (Agilent Technologies) using the fluorometer function (410-20nm excitation bandwidth ...
-
bioRxiv - Microbiology 2020Quote: ... The concentration of quinoline and 2-hydroxyquinoline were analyzed by HPLC system (Agilent, ZORBAX SB-C18 reverse-phase column ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Microbiology 2024Quote: ... samples were cleared for 7 min at 14,000 × g at 4 °C and transferred to LC-MS polypropylene conical vials (Agilent). Vials were stored at −80 °C until analysis using LC-MS.
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Microbiology 2024Quote: ... Amplicons (each 3-4 kbs in length) were generated via PCR using EasyA polymerase (Agilent) and Sanger sequenced.
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... p53 (clone DO-7, Dako; RRID:AB_2889978); p53 ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Neuroscience 2021Quote: ... Approximately 7× 106 AAV 293 cells (Agilent) were seeded in DMEM containing 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... 7 mm column (Agilent, Santa Clara, USA), using an 8 min linear gradient of 40% to 100% methanol in acetic acid (0.1% v/v ...
-
bioRxiv - Cancer Biology 2021Quote: ... The labeled complementary RNAs were hybridized onto a whole human genome oligo microarray (4 3 44K; Agilent Technologies). After washing the slides ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Cell Biology 2023Quote: ... and confirmed for RIN > 7 (Agilent 2100 Bioanalyzer). cDNA libraries were constructed at Azenta (South Plainfield ...
-
bioRxiv - Neuroscience 2022Quote: ... Scans were on a 7-T scanner (Agilent, Santa Clara ...
-
bioRxiv - Biophysics 2020Quote: ... flow cytometry analysis was performed by using the trophoblast-specific epithelial cell marker cytokeratin 7 (Maldonado-Estrada et al., 2004) (anti-cytokeratin 7, Dako, Switzerland). Vimentin (anti-vimentin ...
-
bioRxiv - Microbiology 2022Quote: ... 30 sec at 60°C (steps 3 and 4 were repeated 40 times) was done with the AriaMX real-time PCR System (Agilent).
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by incubation with 7 μl StrataClean beads (Agilent) for 16 h at 4°C with constant tumbling ...
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Cell Biology 2022Quote: ... RNA integrity (RINe ≥ 7) was confirmed using Tapestation 4200 (Agilent). The median RINe score was 9.2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis ...
-
bioRxiv - Neuroscience 2024Quote: ... well above the 7 cutoff (Agilent Technologies, Santa Clara, CA). RNA concentration was determined with Quant-it RNA High Sensitivity assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... 12 by PCR using primers 3 and 4 listed in Supplementary Table 1 and cloned into the BamHI-KpnI site of pBluescript II KS (+) (Stratagene, CA, USA) using ligation mix (Takara Bio USA) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies were mouse anti-Cytokeratin 7 (DAKO - M7018, 1:400), Rabbit anti-Cytokeratin 20 (Abcam - ab76126 ...
-
bioRxiv - Neuroscience 2021Quote: ... Images were acquired on a 7 Tesla MRI scanner (Agilent Inc.) (23 ...
-
bioRxiv - Immunology 2023Quote: ... or R-phycoerythrin-cyanine-7 (PE-Cy7) fluorochromes (Prozyme, Thermo-Fisher).
-
bioRxiv - Immunology 2024Quote: ... Samples with an RNA integrity number (RIN) below 7 (BioAnalyzer, Agilent) did not proceed to sequencing.
-
bioRxiv - Biochemistry 2024Quote: ... Only high-quality RNA (RNA integrity number > 7, Agilent 2100 Bioanalyzer) was used for microarray analysis ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen-antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with hematoxylin (Dako ...
-
bioRxiv - Physiology 2022Quote: ... Antigen–antibody complexes were revealed with 3-3′- diaminobenzidine (K346811, Dako) or the DAB (Polymer ...
-
bioRxiv - Cell Biology 2024Quote: ... at 1:500 and 3-3’-diamino-benzidine-tetrahydrochloride (Dako, K3468). Stained sections were imaged using an NanoZoomer 2.0HT (Hamamatsu).
-
bioRxiv - Cancer Biology 2024Quote: ... Antigen–antibody complexes were reveled with 3-3′-diaminobenzidine (K346811, Agilent). Sections were counterstained with hematoxylin (CS700 ...
-
bioRxiv - Physiology 2020Quote: ... blocked with 3% BSA in PBS1 and incubated overnight at 4°C with primary polyclonal antibodies for glucagon and insulin (Dako, Agilent, Santa Clara, CA, USA) (Table S8) ...
-
bioRxiv - Immunology 2021Quote: A multi-channel 7 Tesla MRI scanner (Agilent Inc., Palo Alto, CA) was used to image brains in skulls ...
-
bioRxiv - Neuroscience 2023Quote: ... At day 7 of differentiation astrocytes were switched to XF media (Agilent) and then assessed using the previously described Mitochondrial Stress Test Protocol [24] ...
-
bioRxiv - Microbiology 2021Quote: ... Tissue sections were colored via DAB-staining (3, 3-diaminobenzidine; Dako, K3468).
-
bioRxiv - Physiology 2020Quote: ... blocked with 3% BSA in PBS1 and incubated overnight at 4°C with primary polyclonal antibodies for glucagon and insulin (Dako, Agilent, Santa Clara, CA, USA) (Table S8) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-Diaminobenzidine (DAB, Agilent) and then counterstained with haematoxylin (Abcam) ...
-
bioRxiv - Molecular Biology 2021Quote: ... was generated from a 7-kb genomic clone from Lambda FIX Library (Stratagene) (Supplemental Fig ...
-
bioRxiv - Neuroscience 2022Quote: ... Postmortem data were then acquired on an 7 T small animal scanner (Agilent) fitted with a 40 G/cm gradient coil (Agilent ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA quality (RIN > 7) was confirmed using an RNA 6000 Nano Kit (Agilent). Spatial gene expression slides were processed following manufacturer instructions (Visium Spatial Gene Expression Reagent Kits User Guide ...