Labshake search
Citations for Agilent :
1401 - 1450 of 6356 citations for 17 Hydroxyprogesterone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were washed in PBS and incubated in DAPI (1:500) for 5 min before mounting with the immunofluorescence mounting media (DAKO).
-
bioRxiv - Plant Biology 2023Quote: ... The sample (5 µl injection volume) was separated on a ZORBAX Eclipse Plus C18 (2.1×50 mm, 1.8 µm, Agilent Technologies, Inc.). Data analysis was performed with Agilent Profinder (v10.0 SP1 ...
-
bioRxiv - Bioengineering 2024Quote: ... Two-channel 85 µm z-stack images were taken using a Cytation 5 V3.14 cell imaging multi-mode reader (Agilent Technologies). A total of 21 z-stacks per well and per experiment were recorded and used for post-processing to calculate the cell phenotypic response in each hydrogel model.
-
bioRxiv - Immunology 2023Quote: ... We performed the HPLC with a normal phase Zobax Sil (5 μm, 4.6 × 150 mm) column (Agilent, Santa Clara, CA). Isocratic chromatographic separation was achieved with 10% ethyl acetate/hexane at a flow rate of 1.4 ml/min ...
-
bioRxiv - Physiology 2023Quote: HPLC separation was performed on an Agilent 1100 HPLC system using a 5 µm C18 column (4.6 mm × 150 mm, Agilent-XDB), maintained at 30°C ...
-
bioRxiv - Immunology 2024Quote: ... Greyhound Chemicals), 10% LC-MS grade water (Ultra CHROMASOLV, Honeywell Riedel-de Haën) with 5 uM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Microbiology 2023Quote: ... The optical density was measured at 540 nm and subtracted from readings at 450 nm using the BioTek Cytation 5 Cell Imaging Multimode Reader (Agilent). Concentrations were calculated from standard curves run in parallel.
-
bioRxiv - Cell Biology 2024Quote: The fluorescence from mNG21-10/mNG211 complementation was visualized the day after transfection with the pH2B-mNG211 plasmid using a Cytation 5 microscope (Agilent) equipped with a 20x/0.45 NA phase contrast objective ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The volatile components were separated by a DB-5 capillary column (30 m × 0.25 mm × 0.25 μm, Agilent, CA, USA) using high-purity helium as carrier gas with a 1.5 mL/min flow rate ...
-
bioRxiv - Microbiology 2024Quote: ... and 280 nm with a Eclipse Plus Phenyl-Hexyl column (250 mm length, 4.6 mm diameter, 5 μm particle size, Agilent Technologies). The flow rate was set to 0.5 mL/min for a 70/30 combination of the mobile phase in water and acetonitrile (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2019Quote: Quantitative PCR for the analysis of host genes expression was performed in 384-well plates in a final volume of 5µl using a Bravo Automated Liquid Handling Platform (Agilent Technologies, Palo Alto, CA, USA) and a ViiA 7 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Bioengineering 2021Quote: ... The serial dilution was prepared by the robotic liquid handler in a 6 × 8 (48-well square) deep well plate (Agilent Part number 201306-100) according to the DilutionPlan (Section 3.1.3) ...
-
bioRxiv - Immunology 2022Quote: ... Reactions were stopped by adding 50 μL 3M hydrochloric acid and absorbance at 492 nm was determined on a Synergy 4 plate reader (BioTek, Agilent Technologies inc., CA, USA) or similar ...
-
bioRxiv - Immunology 2022Quote: Naive CD3+ T cells were placed on PLL-coated Seahorse Bioanalyzer XFp culture plates (3 × 105 cells/well) with Seahorse XF RPMI Assay Media (RPMI Medium, pH 7.4, 103576-100; Agilent Technologies, Santa Clara, CA, USA), supplemented with 10 mM glucose (103577-100 ...
-
bioRxiv - Microbiology 2022Quote: ... we triple parafilmed the 96 well plate lid and put it immediately into an optical reader (Biotek synergy HTX, Agilent, Santa Clara CA, USA) which incubated the plate at 30°C ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The well plate was then inserted into the humidified chamber at 37°C of an Agilent Lionheart FX Automated Microscope (Agilent Technologies, Santa Clara, CA). A band pass filter (Thorlabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Growth experiments were conducted (either at 100% air or 90% air / 10% CO2) in a BioTek Epoch 2 plate reader (Agilent, Santa Clara, CA, USA) at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... The cytoplasmic BlaM activity (ratio of blue to green fluorescence) was measured using a Synergy H1 plate reader (Agilent Technologies, Santa Clara, CA, USA).
-
bioRxiv - Plant Biology 2023Quote: ... Peptides were desalted using C18 solid phase extraction columns (Bond Elut SPEC C18, 96 round-well plate, 15 mg, 1 mL, Agilent Technologies, Santa Clara, USA) and a water-jet (vacuum ...
-
bioRxiv - Neuroscience 2023Quote: ... 50,000 cells per well were plated after 3 days of induction in a specialized Seahorse analyzer 96-well plate (Agilent, cat. no. 103774-100). Cells were washed in PBS once and incubated in a hypoxic chamber following the manufacturer’s procedure ...
-
bioRxiv - Synthetic Biology 2023Quote: ... gain = 75 and mKate (585/615, gain = 125) fluorescence was measured continuously up to 48 h using a Synergy H1 plate reader (Agilent Biotek, Serial Number 21031715) with continuous linear shaking (1096 cpm ...
-
bioRxiv - Genomics 2023Quote: UV inactivation of virus was performed by delivering 1800 MJ of UV-C light (254 nm) to 250 uL of undiluted viral stock in a 24-well plate using a Stratalinker 1800 (Stratagene California, La Jolla, CA) inside a BSC in the BSL3 ...
-
bioRxiv - Neuroscience 2023Quote: ... 50,000 cells per well were plated after 3 days of induction in a specialized Seahorse analyzer 96-well plate (Agilent, cat. no. 103774-100). 10-12 day old i3Neurons were treated with 5 nM vincristine ...
-
bioRxiv - Plant Biology 2023Quote: The aliquot of 100 µL taken from the lipophilic phase of the MTBE extraction was diluted 10-fold with methanol and the extracts were measured under an Epoch2 96-well plate reader (Biotek/Agilent; Santa Clara, CA, U.S.A.). Spectrum was measured at 470 nm ...
-
Pangenomic Landscapes Shape Performances of a Synthetic Genetic Circuit Across Stutzerimonas SpeciesbioRxiv - Synthetic Biology 2024Quote: ... gain 75) and mKate (Ex 585/ Em 615, gain 125) fluorescence was measured continuously using a Synergy H1 plate reader (Agilent Biotek, Serial Number 21031715) with continuous linear shaking (1096 cpm ...
-
bioRxiv - Neuroscience 2023Quote: ... brains from 5-day-old flies of the appropriate genotypes were dissected and plated at one brain per well on XFe96 plates (Seahorse Bioscience, North Billerica, MA), and metabolic parameters were assayed as described (36 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... using the GeneMorph II random mutagenesis kit (Agilent, USA). The generated PCR products were inserted back into the respective backbones using Gibson Assembly ...
-
bioRxiv - Cancer Biology 2021Quote: ... and XF Cell Mito Stress Test Kit (Seahorse Bioscience). Cells were seeded at 50,000 cells/well (~80-90% confluent when assayed ...
-
bioRxiv - Cancer Biology 2021Quote: ... The XF Cell Mito Stress Test Kit (Agilent, 103015), was used for the assay ...
-
bioRxiv - Cell Biology 2020Quote: ... ookinete and sporozoites using an RNA purification kit (Stratagene). cDNA was synthesised using an RNA-to-cDNA kit (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quality control for constructed library was performed by Agilent Bioanalyzer High Sensitivity DNA kit (Agilent Technologies, 5067-4626) for qualitative analysis ...
-
bioRxiv - Genetics 2021Quote: ... and subcloned using Strataclone PCR Cloning Kit (Agilent 240205). Either Donorguide or ssODN injected zebrafish were combined ...
-
bioRxiv - Developmental Biology 2021Quote: ... together with Bioanalyser High Sensitivity RNA Anlysis Kit (Agilent). 1 ng of RNA template was subjected to cDNA synthesis using SuperScript™ VILO™ cDNA Synthesis Kit (Thermo Fisher) ...
-
bioRxiv - Immunology 2020Quote: ... and quality assessed by Bioanalyser (DNA HS Kit, Agilent). Libraries were then constructed from 150 pg of cDNA using the Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Developmental Biology 2020Quote: ... with the High Sensitivity DNA Kit (5067-4626, Agilent). The sequencing libraries were prepared using the KAPA Hyper Pre-Kit (KR0961 – v6.17 ...
-
bioRxiv - Genomics 2020Quote: ... Total RNA isolated using the RNA extraction kit (Agilent) as per manufacturing instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... using the Quikchange II XL mutagenesis kit (Agilent Technologies). These vectors were recombined via Gateway technology to pDONR-Zeo vectors (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... using the Quikchange II XL mutagenesis kit (Agilent Technologies). 2 ...
-
bioRxiv - Cancer Biology 2019Quote: Agilent SureSelectXT library prep ILM Kit (Agilent Technologies, #G9611A) was used to prepare the library for each sheared mouse DNA sample ...
-
bioRxiv - Immunology 2019Quote: Seahorse XF Mito Stress test kits and cartridges (Agilent) were prepared per manufacturers protocol and as previously described (Bossche et al. ...
-
bioRxiv - Systems Biology 2019Quote: ... according to Agilent microRNA Hybridization Kit protocol (Agilent, UK) and scanned using Agilent G2505B array scanner ...
-
bioRxiv - Systems Biology 2019Quote: ... and polished with a PCR polishing kit (Agilent, # 200409) to generate blunt-end DNA ...
-
bioRxiv - Neuroscience 2019Quote: ... and RNA integrity was determined by Agilent 2100 bioanalyzer and RNA 6000 Nano kit (Agilent Technologies). Paired-end libraries were synthesized using the TruSeq RNA library preparation kit (Illumina) ...
-
bioRxiv - Biochemistry 2019Quote: ... Quick Change site-directed mutagenesis kit from Stratagene (USA), restriction enzymes and ligases from New England Biolabs (NEB ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... We used a Dako EnVision Systems HRP kit (Dako) for the secondary antibody ...
-
bioRxiv - Biophysics 2019Quote: ... Point mutations were obtained using a QuickChange kit (Agilent). Linker regions with different lengths sub-cloned between construct using the NheI and KpnI sites flanking the linker ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA of each sample was extracted using TRIzol Reagent (Invitrogen)/RNeasy Mini Kit (Qiagen)/other kits and was quantified and qualified by Agilent 2100 Bioanalyzer (Agilent Technologies ...