Labshake search
Citations for Agilent :
1651 - 1700 of 6356 citations for 17 Hydroxyprogesterone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Microbiology 2023Quote: ... approximately 2 µg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed three times with 1x PBST for 5 min and incubated with secondary antibodies anti-mouse-HRP (1:10,000) (Agilent Dako, #P0447) and anti-rabbit-HRP (1:10,000 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... held for 5 min and connected to the GC-MS (Agilent 7890B GC and 5977 MS, Agilent Technologies, Palo Alto, USA) via a heated transfer line (300 °C) ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was additionally purified with ZymoResearch DNA Clean & Concentrator-5 columns (D4003T) and digested DNA profiles confirmed using the 2100 Bioanalyzer with the Agilent DNA High Sensitivity chip (Agilent Technologies). The libraries were then prepared using the Qiaseq Ultra Low Input Library Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... Chromatography was carried out using a Zorbax SB C18 column (150 × 2.1 mm, 5 µm, Zorbax, Agilent, Santa Clara, CA, USA) which was proceeded with a SB-C18 Guard Cartridges (12.5 × 2.1 mm ...
-
bioRxiv - Microbiology 2023Quote: ... muropeptide originating from peptidoglycan extracted from the same number of cells (1.5×109) were analyzed by reverse phase-ultra high-pressure liquid chromatography (RP-UHPLC) using a 1290 chromatography system (Agilent Technologies) equipped with a Zorbax Eclipse Plus C18 RRHD column (100×2.1 mm ...
-
bioRxiv - Bioengineering 2023Quote: ... slides were counterstained with DAPI (1µg/ml) in PBS for 5 min followed by water washes and cover slipping with fluorescent antifade mounting reagent (DAKO, Agilent).
-
bioRxiv - Cancer Biology 2024Quote: Adherent cell growth assays were performed via label free live cell imaging using the Cytation 5 Imaging Multi-Mode reader with attached BioSpa (Agilent BioTek). For 72 hr growth analysis cells were plated at ∼500 cells/well while for 144 hr growth analysis cells were plated at ∼100 cells/well ...
-
bioRxiv - Genetics 2023Quote: ... we inserted a wild-type histone array sequence containing the 5 replication-dependent histone genes into a pBluescript II KS+ vector (Agilent #212207) and introduced mutations using a Q5 Site-Directed PCR Mutagenesis Kit (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... Sections were washed three times for 5 min each in TBST and mouted with flourescence mounting medium (Dako, Santa Clara, USA). Images of immunofluorescence secitons were captured by confocal microcopy FV1000 (Olympus ...
-
bioRxiv - Physiology 2024Quote: ... were subjected to quantitative PCR under a temperature profile of 95°C for 3 min followed by 40 cycles for 95°C for 5 sec and 58°C for 15 sec using the Stratagene Mx3000P (Agilent Technologies). For each of the samples ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Fluorescence of supernatants was measured at 555/596 nm excitation/emission wavelength (Cytation 5 Multi-Mode Microplate Reader, Agilent, Waldbronn, Germany). 1X alamarBlue reagent solution in ALI medium was used as blank.
-
bioRxiv - Neuroscience 2024Quote: ... Sections were washed 5 x 15 min in PBST at RT and slides were mounted in DAKO fluorescent mounting medium (Agilent Technologies). EdU staining was performed on sections from larvae that received an EdU pulse ...
-
bioRxiv - Neuroscience 2024Quote: ... 6.5-9) and concentration (5-50 ng/µl; 260/280 values >1.7) were evaluated using the Agilent 2100 Bioanalyzer (Agilent Technologies, CA) and Nanodrop (Thermo-fisher ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 µL of eluted RNA and 5 µL RNA ScreenTape sample buffer was mixed in an 8-well PCR tube strip (Agilent Technologies) via vortexing for one minute (IKA MS3 Vortexer ...
-
bioRxiv - Bioengineering 2024Quote: ... with 9 z-stack images were taken every 12 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). The distance between the z-stack is described in each experiment ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Cancer Biology 2024Quote: ... using miR30-adapted sequences (5-6 shRNAs per target) by PCR-cloning a pool of oligonucleotides synthesized on 55k customized arrays (Agilent Technologies) using a well-established system 84–87 ...
-
bioRxiv - Microbiology 2024Quote: ... approximately 2 μg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 μm, 300Å, 1x75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 μl/min (solvent A ...
-
bioRxiv - Bioengineering 2021Quote: ... The electrical characteristics of the brain phantom were determined with a VNA equipped with a dielectric probe kit (85070E kit, Agilent Technologies, Santa Clara, CA) and were representative of the averaged human brain (er = 66.34 and σ = 0.49 S m−1) ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA quality was assessed using an Agilent RNA Nano kit on a BioAnalyzer instrument (RNA 6000 Nano Kit, Agilent, Santa Clara, CA, United States). Libraries were subsequently prepared and sequenced at Psomagen ...
-
bioRxiv - Genomics 2024Quote: ... RNA quality was assessed using an Agilent 2100 Bioanalyzer with an RNA 6000 Nano Kit or RNA 6000 Pico Kit (Agilent Technologies, Santa Clara, CA). ERCC ExFold RNA Spike-In Mixes (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... and examined with the 2100 Bioanalyzer (RNA6000 Pico Kit, Agilent, cat.no ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quick Change XL Site-Directed Mutagenesis Kit (200516, Agilent Technologies) was used to construct ZHX2 mutants ...
-
bioRxiv - Cancer Biology 2021Quote: ... and High Sensitivity DNA Kit (Agilent Technologies, Cat # 5067-4626). Generated DNA fragments were quantified with Qubit dsDNA HS Assay Kit (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... capillary electrophoresis instrument and the CRISPR Discovery Gel Kit (Agilent). To verify that the E-box was successfully replaced by the LexO site ...
-
bioRxiv - Cell Biology 2020Quote: ... Both vectors were edited using the QuickChange® kit (Stratagene) to generate constructs encoding PICK1 coding variants ...
-
bioRxiv - Genetics 2021Quote: Site-directed mutagenesis was performed with QuikChange II kit (Agilent), using manufacturer recommended procedures.
-
bioRxiv - Developmental Biology 2021Quote: ... Quality was confirmed using Agilent RNA 6000 Nano kit (Agilent) on the 2100 Bioanalyzer Instrument (Agilent ...
-
bioRxiv - Genomics 2020Quote: ... DNA libraries were prepared by SureSelectXT Library Prep Kit (Agilent), hybridized to the appropriate capture panel ...
-
bioRxiv - Cancer Biology 2022Quote: ... were sheared by the Sure Select Enzymatic Fragmentation kit (Agilent Technologies Inc. ...
-
bioRxiv - Physiology 2022Quote: ... using an Agilent High Sensitivity DNA Kit (Agilent Technologies, France). Libraries were prepared from 0.15 ng cDNA using the Nextera XT Illumina library preparation kit (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... the QuickChange Site-directed Mutagenesis Kit (Stratagene, La Jolla, CA) was used to introduce the above mutations into the constructs ...
-
bioRxiv - Molecular Biology 2021Quote: ... the Quikchange 2 Site-Directed Mutagenesis Kit (Agilent Technologies 210518) was used to introduce the two mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... XFe96 extracellular flux assay kit probes (Seahorse Bioscience 102601-100) were incubated with the included calibration solution overnight at 37°C under non-CO2-injected conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA content was measured with a Bioanalyzer pico kit (Agilent). 1% RNA SIRVs were spiked-in (Lexogen) ...
-
Nulliparity affects the expression of a limited number of genes and pathways in Day 8 equine embryosbioRxiv - Developmental Biology 2022Quote: ... using an Agilent High Sensitivity DNA Kit (Agilent Technologies, France). Libraries were prepared from 0.15 ng cDNA using the Nextera XT Illumina library preparation kit (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... and an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit). Qualifying samples underwent library construction and sequencing at Novogene ...
-
bioRxiv - Genomics 2020Quote: ... We acquired plasmid pTXB1-Tn5 from Addgene and used the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent) and the Q5 site-directed mutagenesis kit (NEB ...
-
bioRxiv - Genomics 2020Quote: ... and quality checked with Bioanalyzer DNA High Sensitivity Kit (Agilent).
-
bioRxiv - Plant Biology 2019Quote: ... and a Bioanalyzer DNA12000 kit (Agilent, Santa Clara, CA, USA). Twelve µg of non-sheared DNA were used to prepare the SMRTbell library ...
-
bioRxiv - Molecular Biology 2019Quote: ... and analyzed with 2100 Bioanalyzer with DNA 1000 kit (Agilent). Libraries were sequenced on HiSeq 1500 (Illumina ...
-
bioRxiv - Molecular Biology 2019Quote: ... and analyzed with 2100 Bioanalyzer with DNA 1000 kit (Agilent). Libraries were sequenced on HiSeq 1500 (Illumina ...
-
bioRxiv - Physiology 2020Quote: ... and Seahorse XF Mito Stress Test Kit (Agilent, 103015-100). 4 × 104 cells were plated into each well prior to the assay ...
-
bioRxiv - Biophysics 2019Quote: ... Point mutations were introduced using the QuickChange Mutagenesis Kit (Agilent).
-
bioRxiv - Biophysics 2019Quote: ... was performed using the QuikChange kit (Agilent; Santa Clara, CA) or by subcloning synthetic oligonucleotides (Sigma ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The mRNA was assessed using the RNA Pico kit (Agilent) and used to make transcriptome libraries using the PrepX RNA-Seq for Illumina Library Kit (Takara) ...