Labshake search
Citations for Agilent :
1351 - 1400 of 4671 citations for Mouse Anti Dengue Virus Envelope Protein Serotypes 1 3 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The following primary antibodies were used: anti-Insulin (1:50, Dako) and anti-Glucagon (1:100 ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-GFAP (1:500, Dako, Santa Clara, CA, USA, Z0334), mouse anti-GFAP (1:500 ...
-
bioRxiv - Systems Biology 2022Quote: ... rabbit anti-goat immunoglobulins/HRP (catalog number P0449; Agilent; 1:10,000).
-
bioRxiv - Microbiology 2022Quote: ... and GFAP (rabbit anti-human GFAP 2033X; 1:2000 dilution; DAKO) specific Ab (conjugated to horseradish peroxidase ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit polyclonal anti-GFAP (1:500; Z0334 Agilent/Dako, Stockport, UK); goat polyclonal anti-Vimentin (1:50 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit polyclonal anti-GFAP (1:500; Z0334 Agilent/Dako, Stockport, UK); goat polyclonal anti-Vimentin (1:50 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Antibodies used for IHC were anti-ER (M7047, 1:300, Agilent) and anti-Ki67 (M7240 ...
-
bioRxiv - Cell Biology 2023Quote: ... and anti-rabbit-HRP rabbit IgG-HRP (Dako, P0448, 1/2000). Images were captured on an Amersham 600 Imager (GE Healthcare).
-
bioRxiv - Physiology 2023Quote: ... antibodies and a guinea Pig anti- insulin (1:800 DAKO A0564) antibody while Pck1 levels were assessed using a rabbit anti-PCK1 (1:400 Abcam ab70358 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Antibodies used: Anti-Human CD31 Clone JC70A (Dako, M0823, 1:500); Monoclonal Anti-Actin ...
-
bioRxiv - Genetics 2023Quote: ... or polyclonal goat anti rabbit – HRP antibody 1:2000 (Dako, P0448) in blocking solution for 1.5h at room temperature ...
-
bioRxiv - Physiology 2023Quote: ... the rabbit-polyclonal anti-GFAP antibody (1:1,000; Agilent (formerly DAKO), catalog #z-0334 ...
-
bioRxiv - Physiology 2023Quote: ... the rabbit-polyclonal anti-GFAP antibody (1:1,000; Agilent (formerly DAKO), catalog #z-0334 ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies were anti-IgG rabbit (dilution 1/4000; Dako; P0448) and anti-IgG mouse (dilution 1/10000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-α smooth muscle actin (α-sma) (1:50) (M0851, Dako) or anti-SSTR2 (1:50 ...
-
bioRxiv - Pathology 2021Quote: ... the sections were immunostained with antibodies against the following: glial fibrillary acidic protein (GFAP, polyclonal, 1:1,500, Dako); α-smooth muscle actin (SMA ...
-
bioRxiv - Neuroscience 2021Quote: ... we performed immunohistochemical stainings against glial fibrillary acidic protein (GFAP, rabbit-anit-GFAP, 1:500, Dako, Hamburg, Germany) counterstained with a Cy3-conjugated secondary antibody goat-anti-rabbit (1:200 ...
-
bioRxiv - Immunology 2023Quote: ... Antigens were tetramerized by incubation at a >4:1 ratio of biotinylated protein with streptavidin-PE (Agilent; PJRS25) or streptavidin-APC (Agilent ...
-
bioRxiv - Cell Biology 2020Quote: ... sections were incubated with secondary antibody polyclonal rabbit anti-mouse HRP-conjugate (cat.P0260, Dako, Agilent Technologies, Santa Clara, CA, USA) diluted 1:100 in PBS 1× for 1h at room temperature (RT) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The REAL™ EnVision™ Detection system including anti-rabbit/mouse IgG secondary antibodies and peroxidase/diaminobenzidine (Dako, Agilent Technologies) was used to visualize the primary antibody‑binding cells according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The REAL™ EnVision™ Detection system including anti-rabbit/mouse IgG secondary antibodies and peroxidase/diaminobenzidine (Dako, Agilent Technologies) was used to visualize the primary antibody‑binding cells according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... the sections were rinsed with PBST and incubated in a peroxidase-labeled polymer conjugated with goat anti-mouse immunoglobulin (Dako Envision Plus ...
-
bioRxiv - Cancer Biology 2020Quote: ... to avoid cross-reaction during the incubation of the following cocktail of primary antibodies: mouse monoclonal anti-pan-cytokeratin (clones AE1/AE3, DAKO) to detect the epithelial compartment ...
-
bioRxiv - Molecular Biology 2022Quote: ... sections were incubated for 30 minutes in DAKO Envision-Plus System HRP Labelled Polymer Anti-Mouse (DAKO, Catalog No. K4001). Peroxidase labeling was visualized with the Liquid DAB+ Substrate Chromogen System (DAKO ...
-
bioRxiv - Immunology 2020Quote: ... Cytospots were stained by May-Gruenwald Giemsa stain and mast cells were detected immunohistochemically (monoclonal mouse anti-human mast cell tryptase, Dako). Staining protocols and further details can be found in the supplementary material ...
-
Cholesterol deprivation induces TGFβ signaling to promote basal differentiation in pancreatic cancerbioRxiv - Cancer Biology 2019Quote: ... To detect epithelial/tumoral locations and mesenchymal (stromal) components slides were further stained with the mouse monoclonal “cocktail” of anti-pan-cytokeratin (clones AE1/AE3, DAKO) and anti-vimentin (EPR3776 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and then with the primary (Supplementary Table 2) (overnight 4°C) and the secondary (HRP-conjugated anti-mouse or -rabbit, DAKO) (2h ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were washed thrice in PBS and incubated for 30 min with HRP-conjugated rabbit anti-mouse antibody (DaKo, P0161) diluted 1:5000 in blocking buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... The membrane was washed 3 times 15 minutes with TBST before a 1h incubation of horseradish peroxidase (HRP)-conjugated antibodies (P0447 goat anti-mouse IgG HRP, Dako, 1:2500 or P0399 swine anti-rabbit IgG HRP ...
-
bioRxiv - Neuroscience 2023Quote: Anti-PrP monoclonal antibody ICSM35 (D-Gen Ltd) was used with biotinylated polyclonal rabbit anti-mouse immunoglobulin secondary antibodies (Dako; Agilent) and Ventana proprietary detection reagents utilizing 3,3′-diaminobenzidine tetrahydrochloride as the chromogen (DAB Map Detection Kit ...
-
bioRxiv - Biochemistry 2024Quote: ... The presentation of epitopes of the BinJV/WNVKUN when applied to the membrane was confirmed using a goat anti-mouse Ig (Dako) conjugated gold nanoparticle (AuNP ...
-
Treatment with furosemide indirectly increases inhibitory transmission in the developing hippocampusbioRxiv - Neuroscience 2023Quote: ... The membrane was washed 3 times 15 minutes with TBST before a 1h incubation of horseradish peroxidase (HRP)-conjugated antibodies (P0447 goat anti-mouse IgG HRP, Dako, 1:2500 or P0399 swine anti-rabbit IgG HRP ...
-
bioRxiv - Molecular Biology 2022Quote: ... Rabbit/Mouse (Dako, Denmark).
-
bioRxiv - Developmental Biology 2023Quote: ... p63 (mouse, DAKO, M7317). Sections were extensively washed in 1X PBS and incubated with secondary antibodies (Alexa Fluor 488 anti-rabbit A11008 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse envision (K4001, Agilent) diluted 1:3 with PBS was used for detection of IgG ...
-
bioRxiv - Cancer Biology 2019Quote: ... using an anti-Ki67 monclonal antibody (MIB-1 clone at 1:100 dilution; DAKO Agilent Technologies LDA). The immunohistochemistry was scored manually at x400 magnification ...
-
bioRxiv - Cancer Biology 2019Quote: ... using an anti-Ki67 monclonal antibody (MIB-1 clone at 1:100 dilution; DAKO Agilent Technologies LDA). The immunohistochemistry was scored manually at x400 magnification ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Pathology 2024Quote: ... The dish was immunocytochemically stained using antibodies against Ki-67 (mouse monoclonal antibody, clone MIB-1, Dako/Agilent), and cell proliferation was assessed using the Ki-67 immunopositive cell ratio under a 40× objective lens.
-
bioRxiv - Pathology 2024Quote: ... The dish was immunocytochemically stained using antibodies against Ki-67 (mouse monoclonal antibody, clone MIB-1, Dako/Agilent), and cell proliferation was assessed using the Ki-67 immunopositive cell ratio under a 40× objective lens.
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...