Labshake search
Citations for Agilent :
1601 - 1650 of 4671 citations for Mouse Anti Dengue Virus Envelope Protein Serotypes 1 3 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... or IgA (polyclonal rabbit anti-human IgA/HRP, Dako, P0216, at 1:2000 dilution) was added for 1 hr at room temperature and the enzyme reaction was developed with TMB plus (Kementec ...
-
bioRxiv - Neuroscience 2023Quote: ... The following commercial primary antibodies were used: rabbit anti-GFAP (1:1,000; Agilent Dako), mouse anti-NeuN (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... The following commercial primary antibodies were used: rabbit anti-GFAP (1:1,000; Agilent Dako), mouse anti-NeuN (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... The following antibodies were used: rabbit anti-GFAP (1:10,000 dilution; DAKO, cat# Z0334) in combination with goat anti-rabbit Alexa 568 (1:500 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... and swine-anti-rabbit-HRP conjugated secondary antibody (1:1000; P0217; DAKO, Agilent, USA). Detection of antibodies was performed using Intas Infinity ECL Starlight (Intas ...
-
bioRxiv - Cell Biology 2023Quote: ... and swine-anti-rabbit-HRP conjugated secondary antibody (1:1000; P0217; DAKO, Agilent, USA). Detection of antibodies was performed using Intas Infinity ECL Starlight (Intas ...
-
bioRxiv - Bioengineering 2023Quote: ... the primary antibodies included rabbit anti-GFAP polyclonal antibody (1:200, Dako, CA, USA) and mouse anti-TUBB3 (1:50 ...
-
bioRxiv - Cancer Biology 2023Quote: ... France) or anti-CD68 (clone PGM1, dilution 1/100, Agilent Technologies, Les Ulis, France) antibody ...
-
bioRxiv - Cell Biology 2023Quote: ... Insulin was visualized using an anti-insulin antibody (code A0564, 1:1000 dilution, Dako) and anti-guinea pig Alexa Fluor 594 (1:400 dilution ...
-
bioRxiv - Immunology 2023Quote: ... Immunodetection was performed by incubation with horseradish peroxidise-conjugated anti-rabbit (1:5000) (DAKO) and developed by enhanced chemiluminescence (Millipore).
-
bioRxiv - Immunology 2023Quote: ... or a monoclonal anti-C5b-9 antibody against the neoepitope (1:100, Agilent Dako) and incubated for 1h at RT ...
-
bioRxiv - Immunology 2023Quote: ... or a monoclonal anti-C5b-9 antibody against the neoepitope (1:100, Agilent Dako) and incubated for 1h at RT ...
-
bioRxiv - Physiology 2024Quote: ... The following primary antibodies were used: guinea pig anti-insulin (Dako A0564, 1:1000), rat anti-BrdU (Novus Biologicals NB500-169 ...
-
bioRxiv - Neuroscience 2024Quote: ... Western blot was performed with anti-tau rabbit polyclonal antibody (1:1000, Dako A0024) and anti-rabbit HRP-conjugated secondary antibody (1:5000 ...
-
bioRxiv - Immunology 2024Quote: ... 2,5.105 PMN were incubated with different treatments and then stained for 30 min with a specific mouse anti-human CD11b antibody conjugated with PE (Dako, Santa Clara, CA, USA) at 4°C for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Plant Biology 2021Quote: ... at 37⁰C (1:50 protein/trypsin ratio) and cleaned up with a C18 column (OMIX C18, Agilent, Santa Clara, CA, USA). Nano-liquid chromatography-tandem mass spectrometry (nanoLC-MS/MS ...
-
bioRxiv - Neuroscience 2021Quote: ... the co-cultures were incubated first with primary antibody for glial fibrillary acidic protein (GFAP, 1:400, Z033429-2, Dako, Glostrup, Denmark) prepared in 5% NGS in DPBS overnight at +4 following an incubation with Alexa Fluor405 (A31556 ...
-
bioRxiv - Immunology 2020Quote: ... proteins were tetramerized with streptavidin-APC (Prozyme) or streptavidin-AlexaFluor488 (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Proteins were tetramerized with streptavidin-APC (Prozyme), streptavidin–Alexa Fluor 488 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Additional protein block from Dako (X090930-2) was applied ...
-
bioRxiv - Neuroscience 2023Quote: ... blocked (30 min, protein block X0909, Dako), and stained overnight at 4°C using primary antibodies detecting F4/80 ...
-
bioRxiv - Immunology 2023Quote: ... using the Protein G AssayMAP Bravo (Agilent) system ...
-
bioRxiv - Immunology 2023Quote: ... using the Protein G AssayMAP Bravo (Agilent) system ...
-
bioRxiv - Neuroscience 2020Quote: ... the samples were examined in a detergent insolubility assay adapted from Drisaldi et al.43 and the proteins in the supernatant and pellet were analyzed by Western blot using the anti-tau rabbit polyclonal antibody DAKO (Agilent Technologies Italy SpA, Milan, Italy) (1:10000 dilution) ...
-
bioRxiv - Bioengineering 2022Quote: ... Incubation with secondary antibodies diluted in blocking solution was performed 1 h at RT: anti-rabbit-IgG conjugated to horseradish peroxidase (1:10,000, cat. no. P044801-2; Dako, Carpinteria, CA, USA), anti-mouse-IgG conjugated to horseradish peroxidase (1:10,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... sympathetic ganglia and spinal cords was conducted directly on the slides using primary rabbit anti-HSV-1 (1:100; B0114, DakoCytomation, Carpinteria, CA) and chicken anti-GFP (1:400 ...
-
bioRxiv - Molecular Biology 2023Quote: ... incubated with secondary antibodies diluted in 0.5% WBR in TBST for 1 hour at room temperature (Polyclonal Goat Anti-Rabbit Immunoglobulins/HRP, Agilent Dako #P0448, 1/2000), washed three times with TBST ...
-
bioRxiv - Developmental Biology 2023Quote: Whole-mount immunostaining of differentiated skeletal muscle cells was performed using the monoclonal hybridoma 12/101 primary antibody [38] (1/200 dilution; DSHB #AB-531892) and the EnVision+ Mouse HRP kit (Agilent Technologies, K4007) according to the manufacturer’s recommendations.
-
bioRxiv - Cancer Biology 2022Quote: ... for 1 hour at room temperature followed by treatment with HRP-conjugated anti-mouse secondary antibody (DAKO Envision Plus HRP kit, Dako Denmark A/S, Glostrup, Denmark) for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed with a 3-laser flow cytometer (Agilent Novocyte) and data were processed with FlowJo (v10.1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luminescence was measured using a Cytation 3 Image Reader (Agilent). The luminescence of vehicle-treated controls was set to 100% ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luciferase activities were measured with Cytation 3 Image Reader (Agilent). Firefly luciferase activities were normalized to those of the Renilla luciferase.
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was quantified using the Gen5 Take 3 Module (Agilent BioTek) and assessed for quality with 260/230 absorbance ratio ...
-
bioRxiv - Cancer Biology 2024Quote: ... Absorbase (450nm) was red with BioTek Cytation 3 (Agilent, California, US).
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5 ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-myeloperoxidase (MPO) at a dilution of 1:200 (A039829-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Neuroscience 2022Quote: ... The following primary antibodies were used in this study: rabbit anti-GFAP (DAKO, 1:600), mouse anti-GFAP (Cell Signaling ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were then antibody stained with guinea-pig anti insulin (1:500, Dako, Carpinteria, CA), Alexa Fluor 647 anti guinea-pig (1:1000 Thermo Fisher ...
-
bioRxiv - Cancer Biology 2019Quote: ... washed and then secondary antibody (Envision+System HRP labelled polymer Anti-Rabbit, Dako 1:100).
-
bioRxiv - Physiology 2022Quote: ... fetal capillary endothelium and placental trophoblasts were distinguished using anti-vimentin (Dako Vim3B4: 1:100) and anti-pan cytokeratin (Sigma C2562 ...
-
bioRxiv - Physiology 2020Quote: ... blocked in 20% fetal calf serum (FCS) and incubated with anti-insulin (1/10, Dako) in Antibody Diluent for 2h ...
-
bioRxiv - Bioengineering 2021Quote: ... and incubated overnight at 4 °C with primary antibodies: Anti-GFAP 1:1000 (Z0334, Dako), Anti-CD68 1:400 (MCA1957 ...
-
bioRxiv - Immunology 2019Quote: ... 4°C overnight followed by HRP conjugated goat-anti-rabbit IgG (#P0448, Dako (1:1000). α-Tubulin was used as a housekeeping control (#sc-32293 ...
-
bioRxiv - Cancer Biology 2021Quote: ... the following primary antibody combinations were used: a) Rabbit anti-CD3 (1:50, Dako A0452), incubated overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... and biotinylated anti-rabbit IgG antibody which is produced in goats (E 0432-1 Dako Cyt ...
-
bioRxiv - Immunology 2021Quote: ... 1:2000 HRP-conjugated goat anti-rabbit polyclonal antibody (Dako, Denmark A/S, Cat#P0448) was added and the plate was incubated at 37°C for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Goat Anti-Rabbit Immunoglobulins/HRP (dilution 1:100,000, #P0448, Dako Denmark A/S, Glostrup, Denmark) for 1h in RT ...