Labshake search
Citations for Agilent :
1301 - 1350 of 1684 citations for 7 Chloro 2 iodothieno 3 2 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2023Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... diethyl ether and purified on an Agilent 1200 series High-Performance Liquid Chromatography (HPLC) instrument (10–75% HPLC-grade acetonitrile for 20 minutes at a 2 mL/min flow rate over an Agilent Zorbax C18 column (5 µm, 9.4 x 250 mm) tracked at 220 ...
-
bioRxiv - Microbiology 2020Quote: ... EnvP(b)1CS- with the furin cleavage site mutated from RKTR to SKTR was generated from the human EnvP(b)1 plasmid using QuikChange site-directed mutagenesis (Agilent). EnvP(b)1 iRBD sequences were synthesized and cloned into a modified pVRC8400 expression vector ...
-
bioRxiv - Biochemistry 2019Quote: ... and pZeoPTPζ-ΔD2 (the D2 deletion mutant of PTPRZ-B) was generated using pZeoPTPζ as a template with a Quikchange multisite-directed mutagenesis kit (Stratagene).
-
bioRxiv - Microbiology 2021Quote: ... and the Spike from the B.1.429 lineage (S13I, W152C, L452R, D614G) were generated using the QuikChange II XL site-directed mutagenesis kit (Agilent Technologies). The amino acid deletions in the full-length SARS-CoV-2 Spike expressor were generated using the Q5 site-directed mutagenesis kit (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: Initial LC-MSMS discovery mode data for incorporation into a glycopeptide PCDL was performed using Masshunter Qualitative Analysis with Bioconfirm B.07.00 (Agilent Technologies). Compounds were identified using the Find by Molecular Feature (MFE ...
-
bioRxiv - Systems Biology 2020Quote: ... LCMS experiments were performed as described52 and all data processing was performed using the Masshunter Profinder version B.08.00 (Agilent Technologies). The processing was performed both in a target and an untargeted fashion ...
-
bioRxiv - Plant Biology 2021Quote: ... together with mass and retention time alignment (0.1 min and 5 ppm respectively) were done in Profinder B.07 software (from Agilent Technologies). Annotation was done based on the ‘find-by-formula’ algorithm ...
-
bioRxiv - Microbiology 2019Quote: ... and retention time (RT) were imported into a personal compound database and library (PCDL Manager, version B.07.00, Agilent Technologies) used in data processing workflow.
-
bioRxiv - Cell Biology 2022Quote: ... The SEC24A B- and C-site mutants were generated on pcDNA3.1-SmBiT-SEC24A using QuickChange site-directed mutagenesis (Agilent Technologies).
-
bioRxiv - Microbiology 2020Quote: ... Mutations to the NF-κB and IRF binding sites in pLTR(Sp1)-luciferase were generated using the QuickChange IIXL site-directed mutagenesis kit (Stratagene). Primers used for site-directed mutagenesis are listed in Table 1 ...
-
bioRxiv - Plant Biology 2022Quote: ... of target compounds were detected using the ‘find compound by formula’ function and analyzed by Masshunter qualitative and quantitative analysis software version B.07.00 (Agilent technologies). For untargeted analysis ...
-
bioRxiv - Genomics 2021Quote: ... The gel-like image of the 2100 Bioanalyzer result was visualized using the 2100 Expert Software (ver. B.02.11, Agilent Technologies) in pseudo colors with default settings ...
-
bioRxiv - Microbiology 2022Quote: ... The panel of individual RBM mutations in the full-length SARS-CoV-2 Spike expressor and the Spike from the B.1.429 lineage (S13I, W152C, L452R, D614G) were generated using the QuikChange II XL site-directed mutagenesis kit (Agilent Technologies) and were previously reported25 ...
-
bioRxiv - Biophysics 2022Quote: ... and we checked that we obtained a DTCCSHe within 785-791 Å2 of its previously determined value (788 Å2).23 The data were extracted using the IM-MS Browser software version B.08.00 (Agilent Technologies).
-
bioRxiv - Immunology 2022Quote: ... Seahorse XF Cell Culture Microplates were pre-treated with poly-D-lysine and 106 primary B cells or 105 DG75 cells were plate in Seahorse XF Base Medium (Agilent) supplemented with 2mM L-glutamine (Agilent) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... to assess levels of serum psilocin and 2C-B (ng/mL) using liquid chromatography-tandem mass spectrometry liquid chromatography-tandem mass spectrometry (LC-MS/MS; Agilent, Waldbronn ...
-
bioRxiv - Molecular Biology 2023Quote: ... raw LC/MS data was processed by the Molecular Feature Extractor algorithm of MassHunter Qualitative Analysis software B.07.00 (Agilent Technologies). A list of all N-glycans was extracted using previously optimized application of spatial mouse brain glycome database35 ...
-
bioRxiv - Cell Biology 2023Quote: ... Peaks were extracted using MasterHands, automatic integration software (Keio University, Tsuruoka, Yamagata, Japan) (45) and MassHunter Quantitative Analysis B.04.00 (Agilent Technologies) in order to obtain peak information including m/z ...
-
bioRxiv - Cell Biology 2022Quote: Raw LC-MS/MS data were processed using the Agilent Quantitative analysis software (version B.07.00 MassHunter, Agilent Technologies, USA). Relative quantification of metabolites was based on Extracted Ion Chromatogram (EIC ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were injected and separated via gas chromatography on an Agilent 7890 B gas chromatograph (Agilent, Santa Clara, CA, U.S.A.). Coupled to this was a Pegasus HT TOFMS mass spectrometer (Leco Corporation ...
-
bioRxiv - Physiology 2023Quote: ... Some 20 μl of re-dissolved potion (b) and portion (c) solutions were then loaded into injection vials an injection vial (cat. 9301-0978, Agilent Technologies ...
-
Changes in cell morphology and function induced by NRAS Q61R mutation in lymphatic endothelial cellsbioRxiv - Cell Biology 2023Quote: ... Peaks were extracted using MasterHands, automatic integration software (Keio University, Tsuruoka, Yamagata, Japan)13 and MassHunter Quantitative Analysis B.04.00 (Agilent Technologies) to obtain peak information including m/z ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... using automatized integration of the peak area of each compound and standardization of the amount of each peak to its closest internal standard eluting before (MassHunter Workstation, Quantitative Analysis B.07.00 [Agilent Technologies]), thereby correcting for possible injection differences ...
-
bioRxiv - Biochemistry 2024Quote: ... a Personal Compound Database Library (PCDL) exclusively containing cholesterol and cholesteryl esters was curated using MassHunter PCDL manager B.08.00 (Agilent Technologies). The data files were processed in Agilent MassHunter Qualitative Analysis 10.0 using this PCDL library ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... All samples were depleted of the 7 most abundant proteins with the multiple affinity removal system (MARS Hu7 spin cartridge) according to the manufacturers protocol (Agilent Technologies). Samples were further reduced using 4 mM DTT ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Plant Biology 2023Quote: ... RNA samples of at least 200 ng total RNA and achieving a RINe greater than 7 on a 4200-tape station (Agilent Technologies) were selected for RNA sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed with a 3-laser flow cytometer (Agilent Novocyte) and data were processed with FlowJo (v10.1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luminescence was measured using a Cytation 3 Image Reader (Agilent). The luminescence of vehicle-treated controls was set to 100% ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luciferase activities were measured with Cytation 3 Image Reader (Agilent). Firefly luciferase activities were normalized to those of the Renilla luciferase.
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was quantified using the Gen5 Take 3 Module (Agilent BioTek) and assessed for quality with 260/230 absorbance ratio ...
-
bioRxiv - Cancer Biology 2024Quote: ... Absorbase (450nm) was red with BioTek Cytation 3 (Agilent, California, US).
-
bioRxiv - Microbiology 2021Quote: ... (labeled regions A and B) were generated using the primer sets and cycle conditions indicated in Table S1B (EasyA PCR kit (Agilent Tech) and BioRad T100 thermal cycler) ...
-
bioRxiv - Neuroscience 2020Quote: ... Positive and negative raw LC-HRMS files were independently processed with an in-house developed PCDL library for polar and non-polar metabolites using Profinder version B.06 (Agilent Technologies). Metabolites detected in both ionization modes were correlated ...
-
bioRxiv - Neuroscience 2022Quote: ... All point mutations generated using the ankyrin-B-GFP cDNA construct were made using site-directed mutagenesis (QuickChange II XL, Agilent Technologies) and confirmed by DNA sequencing through Eurofins Genomics (Louisville ...
-
bioRxiv - Plant Biology 2021Quote: The raw mass features obtained from UHPLC-ESI/QTOF-MS were processed by using the Agilent Profinder B.06 (Agilent Technologies) software ...
-
bioRxiv - Immunology 2021Quote: Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured in B cells using a Seahorse XF24 Extracellular Flux Analyzer (Agilent Technologies) with kits from Agilent (Santa Clara ...
-
bioRxiv - Plant Biology 2023Quote: ... 2006) and analyzed using 2100 Expert software (version B.02.02, Eukaryote Total RNA Pico Mode, Agilent Technologies, Santa Clara, CA, USA). The RIN of each tissue was above 6 ...
-
bioRxiv - Cell Biology 2022Quote: ... Lipid species were manually identified and lipid data were processed using MassHunter Quantitative Analysis (B.09.00; Agilent, Santa Clara, CA, USA). Data were normalised for recovery ...
-
bioRxiv - Biochemistry 2023Quote: ... the bile acids identified were analyzed by Mass Hunter Qualitative 10.0 qualitative (Version B.10.0, Agilent software metabolomics, Agilent Technologies, Waldbronn, Germany).
-
bioRxiv - Biochemistry 2023Quote: ... Gas chromatograms were manually reviewed for quality control before botryococcene GC peak areas were integrated using MassHunter Workstation software version B.08.00 (Agilent Technologies, USA). The NIST library (National Institute of Standards and Technology ...
-
bioRxiv - Physiology 2021Quote: All samples with the QC and 7 high-pH fractions were acquired using an UHPLC 1290 system (Agilent Technologies; Santa Clara, USA) coupled on-line to an Q Exactive HF mass spectrometer (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... they were first permeabilized using an acetone freeze step for 7 min at -20° C before staining with guinea-pig anti-insulin (Dako, Carpinteria, CA), Alexa Fluor 488 or 647 goat anti-guinea-pig (Thermo Fisher Scientific ...