Labshake search
Citations for Agilent :
1151 - 1200 of 1684 citations for 7 Chloro 2 iodothieno 3 2 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Domain-specific quantification of prion protein in cerebrospinal fluid by targeted mass spectrometrybioRxiv - Neuroscience 2019Quote: ... MS data were analyzed using Spectrum Mill MS Proteomics Workbench software Rev B.06.01.202 (Agilent Technologies). Similar MS/MS spectra acquired on the same precursor m/z within +/-60 sec were merged ...
-
bioRxiv - Microbiology 2021Quote: ... Peak determination and peak area integration were performed with MassHunter Workstation software (Agilent, Version B.08.00). Standard curves were constructed by least-squares linera regression analysis using the peak area ratio of derivatized individual standard against the nominal concentration of the calibrator ...
-
bioRxiv - Cell Biology 2021Quote: ... charge state deconvoluted and deisotoped by the MassHunter Qualitative Analysis software version B.05.00 (Agilent Technologies) and saved as mgf files ...
-
bioRxiv - Biochemistry 2022Quote: ... MS data processing was achieved using Mass Hunter Qualitative Analysis software package (version B.06, Agilent). Finally ...
-
bioRxiv - Cell Biology 2019Quote: Peak integration and quantification was performed using MassHunter Workstation Quantitative Analysis software (version B.07.00, Agilent). Specific high-abundance ions from total ion chromatogram were chosen to calculate each fatty acid peak ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Chromatograms were analyzed with instrumental software Mass Hunter Profinder B.06.00 Profinder (Agilent, Santa Clara CA) with targeted feature extraction ...
-
bioRxiv - Immunology 2022Quote: Raw MS data were analyzed using Spectrum Mill Proteomics Workbench (prerelease version B.06.01.202, Agilent Technologies). A trypsin-specific enzyme search was performed against 2017 uniprot human fasta file (UniProt.human.20171228.RISnrNF.553smORFs.264contams ...
-
bioRxiv - Plant Biology 2023Quote: ... Data analyses were performed using Spectrum Mill MS Proteomics Workbench (Rev B.06.00.201, Agilent Technologies, Inc.) and Mascot Distiller (v2.4.2.0 ...
-
bioRxiv - Cell Biology 2023Quote: Peak integration and quantification were performed using MassHunter Workstation Quantitative Analysis software (version B.07.00, Agilent). Specific high-abundance ions from total ion chromatograms were chosen to calculate each fatty acid peak.
-
bioRxiv - Plant Biology 2023Quote: ... The data were processed in MassHunter Quantitative B.09.00 software (Agilent Technologies, Santa Clara, CA, USA) (Agilent Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... Peak calls and abundance calculations were obtained with MassHunter Workstation Software Version B.06.00 SP01/Build 6.0.388.1 (Agilent). Final concentrations were calculated from a standard curve for each sphingolipid run in parallel.
-
bioRxiv - Genetics 2023Quote: ... quantification and identification were all carried out with Quantitative Analysis MassHunter Workstation Software (Version B.09.00 / Build 9.0.647.0, Agilent Technologies ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The demultiplexing data files (.DeMP.d) were recalibrated using IM–MS Reprocessor (Version B.08.00, Agilent Technologies). The reference masses used for mass calibration were m/z 112.985587 and 1033.988109 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and natural isotope abundance correction were performed by the Agilent Profinder B.10.00 Software (Agilent Technologies).
-
bioRxiv - Microbiology 2023Quote: ... Mass spectra were extracted with MassHunter Qualitative Analysis Software V B.06.00 Build 6.0.633.0 (Agilent Technologies). The obtained mass spectra were transformed to netCDF files and imported into MZmine V2.20 (Copyright 2005−2012 ...
-
bioRxiv - Biochemistry 2023Quote: ... the bile acids identified were analyzed by Mass Hunter Qualitative 10.0 qualitative (Version B.10.0, Agilent software metabolomics ...
-
bioRxiv - Molecular Biology 2023Quote: ... Data analysis and integration of the chromatographic peaks was undertaken in MassHunter (B 10.1, Agilent Technologies) software.
-
bioRxiv - Biochemistry 2023Quote: ... B: 98% acetonitrile/0.1% FA in water) (1290 Infinity II LC system, Agilent Technologies, Waldbronn, Germany). The temperature within the customized LC system was kept at 0 °C to minimize the back exchange ...
-
bioRxiv - Microbiology 2023Quote: Culture supernatant data analyses were performed using MassHunter Quantitative Analysis software (version B.10, Agilent Technologies). Metabolite identifications were confirmed by matching to authentic standard spectra and retention time and spectra in the NIST Tandem Mass Spectral Library Version 2.3 (see Supplementary Tables 12 & 13 for background and validation methods of each metabolite) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Data were processed using MassHunter Quantitative Analysis (for QqQ, version B.07.01/Build 7.1.524.0, Agilent Technologies). Signal intensity drift correction was performed on the pooled QC samples and metabolites with CV > 30% were discarded (Dunn ...
-
bioRxiv - Plant Biology 2023Quote: ... Matrix Science) and confirmed with Spectrum Mill MS Proteomics Workbench (Rev B.06.00.201, Agilent Technologies, Inc.). Search parameters included modifications carboxymethylation and oxidation of methionine ...
-
bioRxiv - Molecular Biology 2024Quote: ... The data were further analyzed with MassHunter Qualitative Analysis Navigator B.08.00 (Agilent Technologies, CA, USA) and LIMSA software67.
-
bioRxiv - Cancer Biology 2019Quote: MRI conducted at UT Southwestern was performed using a 7-Tesla small animal MRI system (Agilent Inc.) with a 40 mm (i.d. ...
-
bioRxiv - Cancer Biology 2019Quote: ... magnetic resonance data were acquired with a 7 T horizontal magnet Agilent ASR 310 (Agilent Technologies Inc.) equipped with nested 205/120/HDS gradient insert and a bore size of 310 mm ...
-
bioRxiv - Neuroscience 2022Quote: ... The pT7-7 plasmid was also modified using site directed mutagenesis (#200523, QuikChange II, Agilent, Waldbronn, Germany) to incorporate a cysteine residue at position 141 to permit dye-labelling of the aSyn protein ...
-
bioRxiv - Neuroscience 2023Quote: ... At day 7 of differentiation as with the mitochondrial stress test astrocytes were transferred to XFmedia (Agilent) and glycolysis was assessed ...
-
bioRxiv - Molecular Biology 2020Quote: ... monoclonal) (Cell Signalling, Danvers, USA), β-actin (#3700, monoclonal) (Cell Signalling, Danvers, USA), and secondary antibodies (P044801-2, polyclonal) from Dako (Agilent, Santa Clara, USA) were used at a dilution 1/1000 (primary ...
-
bioRxiv - Physiology 2020Quote: ... Real-time PCR amplification with the 2 x precision master mix (Primer design, Southampton, UK) using the Stratagene Mx3000P real-time QPCR system (Agilent Technologies, Santa Clara, CA, USA). Each sample was tested in triplicate and compared to a housekeeping gene (Atp5B in osteoblasts and bone tissue ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μL of each sample was injected in splitless and split 1:10 mode into a 6890N gas chromatograph (Agilent Technologies Inc. Santa Clara, CA) coupled to a Pegasus 4D TOF mass spectrometer (LECO ...
-
bioRxiv - Immunology 2022Quote: ... and a tyramide-barcode staining cycle performed for mouse anti-MUM1 primary antibody (1:100 dilution, clone MUM1p, Agilent Dako Products, catalog number GA64461-2). However ...
-
bioRxiv - Molecular Biology 2020Quote: ... and aromatic 1H-13C-NOESY-HSQC experiments with a mixing time of 150 ms each were carried out at 25 °C on a 500 MHz Agilent DirectDrive 2 spectrometer (Agilent Technologies, Santa Clara, CA, USA) equipped with a room temperature probe ...
-
bioRxiv - Immunology 2022Quote: ... then incubated in 5 μg/ml primary antibody in incubation buffer (anti-Mala s 1 mouse monoclonal IgG1 antibody (9G9) from Karolinska Institute (Zagari A et al, 1994, Schmidt et al, 1997) or mouse monoclonal IgG1 antibody (Agilent Dako X093101-2; Santa Clara, USA) as an isotype control for 90 min ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were washed again three times in TBS 1X and immunoreactions were revealed with DAB peroxidase substrate (K346811-2, Agilent Technologies, Santa Clara, CA, USA) was performed ...
-
bioRxiv - Biophysics 2023Quote: The samples were shortly centrifuged after thawing and injected onto a cooled (2°C) HPLC System (Agilent Infinity 1260, Agilent Technologies, Santa Clara, CA, USA) which includes a home packed pepsin column (IDEX guard column with 60 μl Porozyme immobilized pepsin beads ...
-
bioRxiv - Biochemistry 2023Quote: ... The fluorescence at 590 nm with excitation at 485 nm (F590) was measured with the BioTek Synergy 2 plate reader (Agilent Technologies, Santa Clara, CA, USA). The data were fitted using the Hill equation to estimate parameters from data which has the a priori unknown parameters ...
-
bioRxiv - Microbiology 2024Quote: ... Colorimetric conversion was terminated by addition of 5% SDS (50 uL per well) and absorbance was measured at 414 nm using a BioTek Epoch 2 Microplate Spectrophotometer (Agilent Technologies, Santa Clara, CA, USA). The endpoint absorbance of each sample was determined on a plate-by-plate basis where the absorbances of all the blank wells were averaged and multiplied by three ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were washed again three times in TBS 1X and immunoreactions were revealed with DAB peroxidase substrate (K346811-2, Agilent Technologies, Santa Clara, CA, USA). Finally ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...