Labshake search
Citations for Agilent :
1301 - 1350 of 4079 citations for 1 6 ANHYDRO β D GLUCOSE 2 3 4 TRI O ACETATE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... All sections were washed three times for 3 min with PBS and mounted with Dako Fluorescent Mounting Medium (Agilent, USA).
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... LC-MS experiments were carried out on an Agilent 1100 Series LC with a Poroshell 120 EC-C18 column (100 × 3 mm, 2.7 µm, Agilent Technologies) and an Agilent G1956B Series Single Quadripole MS in positive ion mode for mass detection ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were washed with PBS for 15 mins (3×5min fresh solution) and cover-slipped with fluorescent mounting medium (Dako).
-
bioRxiv - Biochemistry 2024Quote: All of the mutations were introduced into a plasmid backbone expressing 6xHis tagged pNL4-3-derived IN by QuikChange site-directed mutagenesis kit (Agilent). The plasmids containing full-length WT and mutants were transformed into BL21 (DE3 ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were washed 3 times for 10 minutes each with TBST and probed with appropriate HRP secondary antibody (anti-Rabbit Immunoglobulin/HRP, Dako P044801 or anti-mouse Immunoglobulin/HRP ...
-
bioRxiv - Bioengineering 2021Quote: ... Serotec) mouse monoclonal antibodies, or Aβ40 (1:200, Covance), Iba-1 (1:200, Wako) and GFAP (1:1000, DAKO) rabbit polyclonal antibodies ...
-
bioRxiv - Neuroscience 2019Quote: ... Incubation with the primary antibody was done overnight at 4°C and with secondary antibodies (DAKO #P0217, #P0260) for 1.5 hours at RT with washing in TBS-Tween trice for 15 minutes each after each incubation ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The column was Poroshell 120 EC-C18 (150 mm × 4.6 mm, 100Å, particle size 4 μm; Agilent Technologies). The injection volume was 10 μL ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 1 μM (OMM2.3) carbonyl cyanide 4-(trifluoromethoxy)-phenylhydrazone (FCCP) and 0.5 μM of a rotenone antimycin A mix (Agilent). Following the assay ...
-
bioRxiv - Cancer Biology 2019Quote: ... Slides were incubated at 4°C overnight and then washed and visualized with DAB+ substrate chromogen (Agilent Technologies). The patient groups with 249T-P positive and negative were divided at 10% cutoff value.
-
bioRxiv - Developmental Biology 2021Quote: ... then at 4°C overnight with primary antibodies diluted in Dako REAL Antibody Diluent (Agilent, Santa Clara, CA). We used the following primary antibodies ...
-
bioRxiv - Cancer Biology 2022Quote: Cells were seeded at 4×104 cells per well in Seahorse XF24 tissue culture plates (Seahorse Bioscience Europe). The sensor cartridge was placed into the calibration buffer medium supplied by Seahorse Biosciences to hydrate overnight ...
-
Lactylation-driven FTO-mediated m6A modification of CDK2 aggravates diabetic microvascular anomaliesbioRxiv - Cell Biology 2023Quote: ... The m6A level was then determined using a Synergy 4 automatic microplate reader (Agilent BioTek; Winooski, VT, USA) at 450 nm.
-
bioRxiv - Genomics 2023Quote: ... which brought the total number of DNA probes to 174,550 spots for a 4×180k microarray (Agilent Technologies). Additional spots on the array were set aside for control grid alignment ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with an eliminated kanamycin-resistance cassette (Supplementary Fig. 4) and XL10-Gold (Agilent Technology, Inc., Santa Clara, CA), were used for cloning and library construction ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were seeded at 4 x 104 cells per well in XFe24 cell culture microplates (Agilent, 102340-100) in 10 ml of DMEM [high glucose DMEM with pyruvate (Gibco ...
-
bioRxiv - Biophysics 2021Quote: ... 2 mL of the cell suspension was loaded into a quartz cuvette (Agilent Technologies). Fluorescence was measured with an Agilent Cary Eclipse fluorescence spectrophotometer with slit widths at 5 and 10 nm for excitation wavelength of 370 nm and emission wavelength of 415 nm ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 µg amplified cDNA was Cy5-labeled using the SureTag DNA labeling kit (Agilent). Hybridization to 8×60K 60mer oligonucleotide spotted microarray slides (Human Mouse Genome ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Data were analysed with the 2–ΔCt method on MxPro qPCR software (Agilent Technologies), and values are expressed as the mean of duplicates.
-
bioRxiv - Pathology 2019Quote: ... Slides were then washed in 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) for 5 minutes ...
-
bioRxiv - Pathology 2019Quote: ... Slides were then washed in 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... unfrationated 2-5A oligomers were run on an HPLC (1260 Infinity II Agilent technologies) equipped with a preparative Dionex column (BioLCRDNAPacRPA-100 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and -2 of the zymogen sequence of KLK3 (Quick Change Lightning Mutagenesis Kit; Stratagene) enabled furin ...
-
bioRxiv - Cancer Biology 2022Quote: ... Stainings were visualized using Liquid DAB+ 2-component system (3,3’-diaminobenzidine, DAKO, Agilent K3467) following the manufacturer’s protocol and washed three times with TBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... Stainings were visualized using Liquid DAB+ 2-component system (3,3’-diaminobenzidine, DAKO, Agilent K3467) following the manufacturer’s protocol and washed three times with TBS ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were then washed 2 times with XF DMEM assay medium (Agilent, #103575-100), supplemented with glucose (Agilent ...
-
bioRxiv - Cell Biology 2020Quote: ... RT-qPCR assays were analyzed with 2(-ΔΔCt) method 85 via MxPro software (Stratagene) and expressed as relative quantity to normalizer 86.
-
bioRxiv - Neuroscience 2022Quote: ... the slides were exposed to a mouse-specific biotinylated secondary antibody (GV82111-2, Dako) for 15 minutes ...
-
bioRxiv - Immunology 2020Quote: ... 500 ng of F(ab’)2 fragments of α-μ (clone JDC-15; Dako [α-human] ...
-
bioRxiv - Microbiology 2019Quote: ... The cells were stained with HAstV mouse monoclonal antibody 8E7 (2 μg/ml DakoCytomation) for 1 hour at room temperature followed by anti-mouse IgG labeled with Alexa Fluor 488 (anti-mouse IgG-Alexa Fluor 488 ...
-
bioRxiv - Genomics 2020Quote: ... and two Peltier thermal stations (CPAC Ultraflat HT 2-TEC, #7000166A, Agilent Technologies, USA) with PCR adapter having a mounting frame at positions 4 and 6 on the Bravo Deck and connected to an Inheco MTC Controller ...
-
bioRxiv - Immunology 2021Quote: ... washed twice with PBS/2% FCS and stained with PE (Prozyme, 20 µg/ml). RNA flow cytometry measurement of Bhlhe40 expression was performed using the PrimeFlow RNA Assay (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... and 2) size distribution using the High Sensitivity DNA BioAnalyzer kit (Agilent, 5067-4626). Libraries were constructed using the Nextera XT library Prep kit (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2 µM Antimycin A + Rotenone (Seahorse XF Cell Mito Stress Test Kit, Agilent) was added sequentially via injection ports ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by HRP-conjugated anti-mouse secondary antibody polymer (EnVision+; Dako-Cat# K400311-2) and visualized by Cy7-tyramide as substrate ...
-
bioRxiv - Microbiology 2024Quote: ... for 24 h or by 15 µg/ml α-human IgG (Agilent #A042301-2) for 48 h ...
-
bioRxiv - Immunology 2024Quote: ... and 2 mM glutamine and analyzed with an XF-96 Extracellular Flux Analyzer (Agilent). Four consecutive measurements were obtained under basal conditions followed by the addition of 1 μM oligomycin ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with primary antibodies diluted in background reducing antibody diluent (Agilent S302283-2) overnight at RT ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-AIF-1/Iba1 (1:1000, 019741 DAKO); and secondary antibodies ...
-
bioRxiv - Pathology 2020Quote: ... and Ki-67 (1:100, MIB-1, Dako) in an Autostainer Link48 automated staining platform (Dako ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-Ki67 (Dako, MIB-1, 1:100), mouse anti-DLX2 (Santa Cruz ...
-
bioRxiv - Immunology 2019Quote: ... RP1-5’-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACG TTC AGA GTT CTA CAG TCC GA-3’ and RPI1-5’-CAA GCA GAA GAC GGC ATA CGA GAT CGT GAT GTG ACT GGA GTT CCT TGG CAC CCG AGA ATT CCA-3’ and the purified library was quantified with 4200 TapeStation (Agilent Technologies) and paired-end sequenced on a Nextseq 500 V2 (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... Each pool of RNA was individually labelled with Cyanine-3 and Cyanine-5 (Cy3 and Cy5) using the Low input Quick Amp Labelling Kit (Agilent Technologies) followed by purification through Qiagen RNeasy Columns (Qiagen ...
-
bioRxiv - Genetics 2019Quote: ... The PAM sequences in the c(3)G gene were mutated using the Quik Change II XL Site-Directed Mutagenesis Kit (Agilent Technology). The bases changed are in bold above ...
-
bioRxiv - Bioengineering 2020Quote: ... Pelleted cells by the centrifugation for 3 min at 300 rcf are stained with FITC-conjugated anti-lysozyme antibody (Dako, F0372) and APC-conjugated anti-CD24 antibody (Biolegend ...
-
bioRxiv - Biochemistry 2020Quote: Measurements in both settings were performed in 3 min mix and 3 min measure cycles at 37 °C in six replicates per condition on a Seahorse XFe96 Analyzer (Agilent Technologies). OCR and ECAR were depicted as pmol/min and mpH/min ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 µm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15 ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Immunology 2021Quote: ... HES5 and GATA6 genes were made for 3 replicates using the Brilliant III Ultra-Fast SYBR green qPCR master mix (Agilent Technologies) and analyzed on a CFX Opus Real-Time PCR system (BioRad ...