Labshake search
Citations for Agilent :
1351 - 1400 of 4302 citations for 1 6 ANHYDRO β D GLUCOSE 2 3 4 TRI O ACETATE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: Primary brown adipose cells were isolated and cultured for 3 days before plated in XF cell culture microplates (Seahorse Bioscience). Cells (10,000 cells ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
bioRxiv - Genetics 2020Quote: Single variants were introduced by mutagenesis of the Tile 3-KCNH2 plasmid (Table S1) using the Quikchange Lightning Multi kit (Agilent), with 1 primer per variant ...
-
p97/VCP induces GLI1 to control XBP1-dependent endoplasmic reticulum stress transcriptional responsebioRxiv - Cancer Biology 2021Quote: ... The cells were washed 3 times with PBS for 5 min and then incubated with a secondary antibody: Flex-HRP (EnVision System, Dako) for 30 min and washed 3 times 5 min with PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... Phosphorylation site mutations and gRNA sequences were introduced into vectors by PCR amplification with mutagenic primers (Table 3) with Phusion (Thermo) or PfuUltra II (Stratagene) polymerase ...
-
bioRxiv - Cancer Biology 2022Quote: ... Glacial acetic acid was added to dissolve the crystals and the absorbance was measured at 595 nm with a Cytation 3 Image Reader (Agilent). The values of vehicle-treated controls were set to 100%.
-
bioRxiv - Molecular Biology 2023Quote: ... Site-directed mutagenesis was used to introduce mutations into the putative miR-423-5p binding sites on the Cacna2d2 3’UTR using the QuickChange II XL site-direct mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... The HLA-I affinity chromatography was performed using a 96-well single-use micro-plate with 3 μm glass fiber and 10 μm polypropylene membranes (Agilent). Sep-Pak tC18 100 mg Sorbent 96-well plates (Waters ...
-
bioRxiv - Microbiology 2022Quote: ... and tRNA was isolated to purity from the small RNA fraction following HPLC on the Bio SEC-3 column (Agilent; 7.8 mm ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: All of the mutations were introduced into a plasmid backbone expressing 6xHis tagged pNL4-3-derived IN by QuikChange site-directed mutagenesis kit (Agilent). The plasmids containing full-length WT and mutants were transformed into BL21 (DE3 ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were washed with PBS for 15 mins (3×5min fresh solution) and cover-slipped with fluorescent mounting medium (Dako).
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were washed 3 times for 10 minutes each with TBST and probed with appropriate HRP secondary antibody (anti-Rabbit Immunoglobulin/HRP, Dako P044801 or anti-mouse Immunoglobulin/HRP ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were resuspended in FACS staining buffer (3% FBS in PBS) and analyzed by flow cytometry on a Novocyte 3000 (Agilent). Flow cytometry results were analyzed using NovoExpress (version 1.5.6).
-
bioRxiv - Microbiology 2023Quote: ... solution and 3 μl of each sample were subjected to high-resolution liquid chromatography-mass spectrometry (LC-MS) analysis (Agilent iFunnel 6550 quadrupole time-of-flight (QTOF) ...
-
bioRxiv - Microbiology 2023Quote: ... along with gene-specific primers listed in Supplemental Table 3 and qPCR was performed in technical triplicate on a StepOnePlus (Stratagene). Ct values of target genes were normalized to β-actin and relative gene expression levels between conditions were calculated via the ΔΔCt method ...
-
bioRxiv - Cell Biology 2023Quote: ... GEMs were used to generate barcoded cDNA libraries following the manufacturer’s protocol (Single Cell 3’ Reagent Kit v3.1, 10X Genomics) and quantified using the TapeStation High Sensitivity D5000 kit (Agilent, Germany). Subsequently ...
-
bioRxiv - Microbiology 2023Quote: ... of HIV-1 were amplified by PCR using KOD-Plus-Neo and pNL4-3 as a template and cloned into pBluescript II KS(-) (212208, Agilent). The MLV 5’-LTR (1 - 207 nt ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were acidified with trifluoroacetic acid (TFA) to lower the pH below 3 and desalted on reversed phase (RP) C18 OMIX tips (Agilent). The tips were first washed 3 times with 100 µl pre-wash buffer (0.1% TFA in water/acetonitrile (ACN ...
-
bioRxiv - Cell Biology 2023Quote: ... then washed 3 × 10minute and post-fixed with 0.1% PFA for 10minutes and mounted using fluorescent mounting medium (DAKO, USA).
-
bioRxiv - Cell Biology 2023Quote: ... the HA epitope sequence was inserted immediately 3’ to the signal peptide sequence by site directed mutagenesis using the QuickchangeXL site directed Mutagenesis kit (Agilent) to obtain the following intermediate vector ...
-
bioRxiv - Physiology 2023Quote: ... The cells were transfected with 100 ng of NF-κB firefly luciferase reporter plasmid p(NF-κB)3-Luc (Stratagene) and 10 ng of Renilla luciferase reporter plasmid pRL-RSV (Promega) ...
-
bioRxiv - Physiology 2023Quote: ... Acetone was measured using an Agilent DB-35MS column (30 m 3 0.25 mm i.d. x 0.25 µm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Physiology 2023Quote: ... and 4 μl of supernatant was injected into an HILIC column (HILIC Silica 3 μm, 2.1 × 150 mm, SN: 186002015; Atlantis) on a 1290 Infinity II LC System (Agilent Technologies) which is interfaced with a 6545 MS (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: Size Exclusion Chromatography in line with Multi Angle Laser Light Scattering (SEC-MALLS) experiments for absolute mass determination were conducted at 25°C with a BioSEC-3 column (Agilent) equilibrated in 20 mM Na-phosphate pH 7.0 ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... LC-MS experiments were carried out on an Agilent 1100 Series LC with a Poroshell 120 EC-C18 column (100 × 3 mm, 2.7 µm, Agilent Technologies) and an Agilent G1956B Series Single Quadripole MS in positive ion mode for mass detection ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were prepared using the QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina (Lexogen) and assessed on a BioAnalyzer 2100 (Agilent) for library quantification and quality control ...
-
bioRxiv - Cell Biology 2023Quote: ... All sections were washed three times for 3 min with PBS and mounted with Dako Fluorescent Mounting Medium (Agilent, USA).
-
bioRxiv - Synthetic Biology 2024Quote: By acidic methanolysis processed PHB (3-hydroxybutyrate methyl ester) was analyzed by gas chromatography (GC 6850, Agilent Technologies, Basel, Switzerland) equipped with a 7683B Series injector coupled to a flame ionization detector (FID) ...
-
bioRxiv - Bioengineering 2021Quote: ... Serotec) mouse monoclonal antibodies, or Aβ40 (1:200, Covance), Iba-1 (1:200, Wako) and GFAP (1:1000, DAKO) rabbit polyclonal antibodies ...
-
bioRxiv - Neuroscience 2019Quote: ... Incubation with the primary antibody was done overnight at 4°C and with secondary antibodies (DAKO #P0217, #P0260) for 1.5 hours at RT with washing in TBS-Tween trice for 15 minutes each after each incubation ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The column was Poroshell 120 EC-C18 (150 mm × 4.6 mm, 100Å, particle size 4 μm; Agilent Technologies). The injection volume was 10 μL ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 1 μM (OMM2.3) carbonyl cyanide 4-(trifluoromethoxy)-phenylhydrazone (FCCP) and 0.5 μM of a rotenone antimycin A mix (Agilent). Following the assay ...
-
bioRxiv - Cancer Biology 2019Quote: ... Slides were incubated at 4°C overnight and then washed and visualized with DAB+ substrate chromogen (Agilent Technologies). The patient groups with 249T-P positive and negative were divided at 10% cutoff value.
-
bioRxiv - Developmental Biology 2021Quote: ... then at 4°C overnight with primary antibodies diluted in Dako REAL Antibody Diluent (Agilent, Santa Clara, CA). We used the following primary antibodies ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were seeded at 4 x 104 cells per well in XFe24 cell culture microplates (Agilent, 102340-100) in 10 ml of DMEM [high glucose DMEM with pyruvate (Gibco ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with an eliminated kanamycin-resistance cassette (Supplementary Fig. 4) and XL10-Gold (Agilent Technology, Inc., Santa Clara, CA), were used for cloning and library construction ...
-
bioRxiv - Cancer Biology 2022Quote: Cells were seeded at 4×104 cells per well in Seahorse XF24 tissue culture plates (Seahorse Bioscience Europe). The sensor cartridge was placed into the calibration buffer medium supplied by Seahorse Biosciences to hydrate overnight ...
-
Lactylation-driven FTO-mediated m6A modification of CDK2 aggravates diabetic microvascular anomaliesbioRxiv - Cell Biology 2023Quote: ... The m6A level was then determined using a Synergy 4 automatic microplate reader (Agilent BioTek; Winooski, VT, USA) at 450 nm.
-
bioRxiv - Genomics 2023Quote: ... which brought the total number of DNA probes to 174,550 spots for a 4×180k microarray (Agilent Technologies). Additional spots on the array were set aside for control grid alignment ...
-
bioRxiv - Neuroscience 2024Quote: ... and then subjected to overnight incubation at 4°C with the primary antibodies: rabbit anti-GFAP (Z0334, DAKO), mouse anti-Rhodopsin (AB5417 ...
-
bioRxiv - Biophysics 2021Quote: ... 2 mL of the cell suspension was loaded into a quartz cuvette (Agilent Technologies). Fluorescence was measured with an Agilent Cary Eclipse fluorescence spectrophotometer with slit widths at 5 and 10 nm for excitation wavelength of 370 nm and emission wavelength of 415 nm ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 µg amplified cDNA was Cy5-labeled using the SureTag DNA labeling kit (Agilent). Hybridization to 8×60K 60mer oligonucleotide spotted microarray slides (Human Mouse Genome ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Data were analysed with the 2–ΔCt method on MxPro qPCR software (Agilent Technologies), and values are expressed as the mean of duplicates.
-
bioRxiv - Pathology 2019Quote: ... Slides were then washed in 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) for 5 minutes ...
-
bioRxiv - Pathology 2019Quote: ... Slides were then washed in 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... unfrationated 2-5A oligomers were run on an HPLC (1260 Infinity II Agilent technologies) equipped with a preparative Dionex column (BioLCRDNAPacRPA-100 ...