Labshake search
Citations for Agilent :
1051 - 1100 of 6761 citations for Pig Glucagon Like Peptide 2 GLP 2 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... embedded in paraffin, and automatically stained for SARS-CoV-2 (2019-nCoV) Nucleocapsid (SINO BIO, #40143-R019) or for fibrin (DAKO, #A0080) through LEICA BOND RX 1h room- temperature (RT ...
-
bioRxiv - Microbiology 2022Quote: ... and Sialyl-Lewis x (sLex/CD15s) were detected with 2 µg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX-1 (Becton Dickinson ...
-
bioRxiv - Cancer Biology 2020Quote: ... at 4°C overnight followed by incubation with Dako EnVision+System-HRP Labelled Polymer Anti-Mouse (Aglient Dako, Cat # K400111-2) for 60 min at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... by placing the virus for 2 minutes in a UV Stratalinker 2400 equipped with 365 nm long-wave UV bulbs (Stratagene, USA). UV-inactivation was confirmed by lack of cytopathic effect on BSC-1 cells infected with i-VACV for up to 3 days (data not shown).
-
bioRxiv - Biochemistry 2021Quote: ... was added to a final concentration of 0.5% along with 2 µL of PNGase F Ultra (Agilent Technologies, Santa Clara, CA) and incubated for 1 hour at 37 °C before subsequent 2-AB/2-AA labelling ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples for both the high pressure experiment and ambient pressure control experiment were prepared in 2 mL glass headspace vials (Agilent Technologies) whose caps were pierced with a needle.
-
bioRxiv - Genetics 2021Quote: ... The quality of the DNA was determined by agarose gel electrophoresis and by determining the OD260:OD280 ratio using a Nanodrop spectrophotometer (Epoch 2, Agilent BioTek). De novo genome sequencing was carried out by Novogene (www.novogene.com ...
-
bioRxiv - Neuroscience 2021Quote: The optimal concentration was determined for each antibody: CD3 (polyclonal rabbit – anti-human CD3 IgG, cat. no. A045201-2, Agilent Technologies), 1:60 ...
-
bioRxiv - Developmental Biology 2021Quote: PSM cells were dissociated on day 2 of differentiation and reseeded onto fibronectin-coated Seahorse plates (Agilent cat. no. 101085-004) at a density of 7 x 105 cells per cm2 in Seahorse XF DMEM (Agilent cat ...
-
bioRxiv - Microbiology 2020Quote: ... Sialyl-Lewis a and Sialyl-Lewis x (sLex also known as CD15s) were detected with 2 μg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX1 (Becton Dickinson ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were enriched with 2 cycles of PCR then assessed for size distribution using the 4200 TapeStation High Sensitivity D1000 ScreenTape (Agilent Technologies) and quantified using the Qubit dsDNA HS Assay Kit (Thermo Fisher) ...
-
bioRxiv - Immunology 2021Quote: ... Antigen retrieval was performed for 15 min in the autoclave (250°F) using 1x Target antigen retrieval solution (Dako; S169984-2). All antibody steps were performed as described above ...
-
bioRxiv - Immunology 2021Quote: ... Slides were then rinsed with double distilled water (ddH2O) and boiled in 1X Dako pH9 antigen retrieval solution (Agilent, S236784-2) for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were then washed in PBS/0.05% Tween 20 and incubated with rabbit anti human VWF (A008229-2, DAKO/Agilent tech) 1/500 or rabbit IgG isotype control (AB-105-C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the absorbance decrease at 340 nm was immediately measured for 2 minutes in a Cary 60 UV-Vis spectrophotometer (Agilent Technologies) at 23 °C to obtain the initial reaction rate of the enzymes (V0) ...
-
bioRxiv - Neuroscience 2022Quote: ... The absorbance of the samples was measured at 540 nm using a Biotek Epoch 2 microplate spectrophotometer (Agilent, Santa Clara, CA). The standard curve of sodium nitrite (0-100 μM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Peptides were re-dissolved in 100 µL solvent A (0.1% TFA in water/ACN (98:2, v/v)) and injected for fractionation by RP-HPLC (Agilent series 1200) connected to a Probot fractionator (LC Packings) ...
-
bioRxiv - Molecular Biology 2024Quote: ... washed in TBST and incubated for 1-2 h with the peroxidase-coupled secondary antibody (HRP-coupled anti-rabbit IgG (Dako, #P0448), HRP-coupled anti-mouse IgG (Dako ...
-
bioRxiv - Microbiology 2024Quote: ... approximately 2 μg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 μm, 300Å, 1x75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 μl/min (solvent A ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumor xenograft slides were incubated at 60 °C for 2 h followed by antigen retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Microbiology 2023Quote: ... approximately 2 µg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescence spectroscopy measurements of 2 μM of each protein sample were obtained using the Varian Cary Eclipse Fluorescence Spectrophotometer (Agilent Technologies) with an excitation wavelength of 280 nm and recording the emission spectra between 300 nm and 400 nm.
-
bioRxiv - Biochemistry 2023Quote: ... Mutations were introduced into the generated pE-SUMO-α-actinin-2 ABD through site-directed PCR mutagenesis (PfuUltra High-Fidelity DNA Polymerase, Agilent). The following primers were used to introduce cardiomyopathy mutations into the α-actinin-2 ABD sequence.
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies were the following: goat anti-mouse IgG conjugated to horseradish peroxidase (IB: 1:10,000, cat#P044701-2 Dako, Glostrup, Denmark), donkey anti-Rabbit IgG Alexa Fluor 488 (IF ...
-
bioRxiv - Neuroscience 2023Quote: ... for 60 min and incubated overnight at 4°C with primary antibodies diluted in DAKO Antibody Diluent (Agilent, cat. #S080983-2). Sections were washed in PBS (3 x 5 min ...
-
bioRxiv - Immunology 2024Quote: ... 11 cycles of TCR target enrichment PCR 1 and 2 were performed and the resulting cDNA was quantified on an Agilent Bioanalyzer High Sensitivity chip (Agilent Technologies). TCR libraries were prepared and indexed with 9 cycles of amplification using the PN-220103 Chromium i7 Sample Index Plate ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 min) before incubation with either rabbit anti-mouse IgG (1.3 µg ml−1, 1% BSA in PBST; Agilent, P026002-2), goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Microbiology 2023Quote: ... strains carrying the empty plasmid pME6032 or pME6032 harboring natT or natR copies were grown ON in LB supplemented with Tet 100 μg/ml and then diluted to an OD 0.05 with fresh LB supplemented with different concentrations of IPTG (0 - 250 μM) and grown in microtiter plates in an Epoch-2 reader (Agilent Technologies). 20 mM NAM was supplemented where indicated.
-
bioRxiv - Neuroscience 2023Quote: ... The reaction mixture was incubated for 2 at RT and subsequently applied to a semipreparative RP-HPLC C8 column (Zorbax-300 SB, Agilent, GE) connected to an HPLC system (Agilent 1260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Microbiology 2024Quote: ... Cultures were grown at 30 °C in 96-well plates in an BioTek Epoch 2 shaking incubator (Agilent, Santa Clara, CA) for 72 hours.
-
bioRxiv - Cancer Biology 2024Quote: Sections from primary tumors and the matched axillary node with the largest metastatic focus (≥ 2 mm) were used for assessment of nerves (Neurofilament antibody, DAKO M0762), and angiogenesis markers (Factor-VIII ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... was added to 2 mL of each of the sample supernatants before analysis by inductively coupled plasma-mass spectroscopy (ICP-MS, 7700x, Agilent Technologies) using an ASX-500 autosampler (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2024Quote: ... The glycolytic activity or glycoPER in response to Rotenone/Antimycin A and 2-deoxy-D-glucose was measured using glycolytic rate assay (Agilent, USA). All measurements were performed using Seahorse XFe96 Bioanalyzer (Agilent ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary (FHL2 2 µg/mL and Ki67 2 µg/mL) and secondary antibodies (same as for in vitro immunofluorescence staining) were diluted in Dako antibody diluent (Dako, Germany). Washing steps were done in Dako washing buffer ...
-
bioRxiv - Immunology 2024Quote: BT-474-Luc2 cells (2 x 104 cells/well) were seeded in 96-well RTCA E-Plate (Agilent, Santa Clara, CA) and left to adhere for 24 hours ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The samples (2 µL) were resolved through an Agilent Poroshell 120 SB-C18 column (Agilent, 3.0 x 75 mm, 2.7 µm) maintained at 55°C at a flow rate of 0.40 mL/min with a multi-step gradient previously published using 0.1% formic acid in MilliQ water (mobile phase A ...
-
bioRxiv - Cancer Biology 2021Quote: ... the membranes were washed 3X with TBST followed by incubation with HRP-conjugated secondary antibodies (Rabbit Cytiva/Amersham NA934; Mouse Agilent/Dako P026002-2) for one hour at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: Immunofluorescence microscopy was performed on de-paraffinized tissue sections that received heat-induced antigen retrieval using Target Retrieval Solution (Agilent Dako, S169984-2). After washing and permeabilization in TBS-T universal buffer (0.2% Triton X-100 in tris-buffered saline) ...
-
bioRxiv - Immunology 2021Quote: ... and bound serum IgG was detected by 70 µL/well of 1:3000 diluted rabbit anti-human IgG antibody linked to horseradish peroxidase (Agilent, P021402-2) incubated for 2h at RT ...
-
bioRxiv - Developmental Biology 2019Quote: ... and incubated for 2 hours at room temperature with a biotinylated goat anti-rabbit secondary antibody (Dako, 1:500 in blocking solution). Cells were washed 3 times and incubated for 30 minutes with streptavidin Cy3 (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: ... Sections were then treated with Proteinase K (20 μg/mL) for 15 minutes for antigen retrieval and blocked with DAKO background reducing protein blocking agent (Agilent, X090930-2) prior to 1 hour incubation of CD206 (1:200 ...
-
bioRxiv - Biophysics 2021Quote: ... The cell suspension was then centrifuged at 8000 RPM for 2 minutes and the supernatant was collected and measured using a fluorescence spectrophotometer (Agilent Cary Eclipse). Using a similar measurement without the RBCs ...
-
bioRxiv - Cell Biology 2021Quote: ... FAMEs were re-dissolved in 2 ml pentane and chromatographed using a GC/MS instrument (SHIMADZU, QP2010 Ultra) with a DB-23 GC column (Agilent, 122-2332). FAME peaks were identified according to the fatty acid standards and integrated to calculate the TAG amount ...
-
bioRxiv - Immunology 2021Quote: ... Paraffin sections (4µm thick) of FFPE thymus and lymph node tissues (NMR, mouse, and human control) were stained for cytokeratin (AE1/AE3, Dako GA05361-2) on a Dako Omnis autostainer with pressure cooker antigen retrieval (TrisEDTA ...
-
bioRxiv - Microbiology 2021Quote: ... were acidified with 5 µl of 30% HCl per 2 mL to prevent precipitation and measured by inductively coupled plasma optical emission spectroscopy (ICP-OES, Agilent Technologies 5100). Porewater for dissolved inorganic carbon (DIC ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides with PCa tissue samples (n=144) were incubated at 60°C for 2 hours followed by target retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Cancer Biology 2022Quote: ... by polymerase chain reaction (PCR). Ki-67 (Catalog no. M7240) and CD4 (Catalog no. M731029-2) antibodies were purchased from Dako (CA, USA). FOXO3a (Catalog no ...
-
bioRxiv - Microbiology 2022Quote: ... Sialyl-Lewis a (sLea) and Sialyl-Lewis x (sLex/CD15s) were detected with 2 µg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX-1 (Becton Dickinson ...