Labshake search
Citations for Agilent :
1051 - 1100 of 4607 citations for 7 methyl 4 methylidene 1 propan 2 yl 2 3 4a 5 6 8a hexahydro 1H naphthalene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype: rabbit immunoglobulin fraction, DAKO). Alexa labeled secondary antibodies (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... acetonitrile and 2 µl was injected for the analysis with LC/MS (6520 Accurate-Mass Q-TOF connected to Agilent 1100 Series HPLC ...
-
bioRxiv - Cell Biology 2023Quote: Oxygen consumption rate of U2OS WT and G3BP1/2 dKO cells was measured on an extracellular flux analyzer (Agilent Seahorse) using the XF Cell Mito Stress Test Kit following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: Paraffin-embedded human HCC samples were cut into 3.5-µm thick tissue sections and processed for immunohistochemistry with the EnVision FLEX kit material (K800021-2, Agilent Dako) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... Peptides were desalted as previously described (60) using an OT-2 liquid handling robot (Opentrons Labworks Inc.) mounted with Omix C18 pipette tips (A5700310K; Agilent). Desalted peptides were dried and stored at - 80°C prior to re-suspension in 3.0% (v/v ...
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.2% Triton X-100 and incubation with appropriate secondary antibody for 2 hr at room temperature in blocking buffer before washing and mounting in fluorescent mounting medium (DAKO). Images were acquired using a Leica SP8 confocal microscope ...
-
bioRxiv - Cell Biology 2023Quote: ... membranes were washed 3 times with TBS-T and subsequently incubated with secondary antibodies (Dako, 1:5000) diluted in 5% marvel in TBS-T for 1 h at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... in 3 cycles for 3 hours using the Seahorse XFe24 analyzer system (Agilent Technologies). Inhibitors and substrates were used at the following concentrations ...
-
bioRxiv - Developmental Biology 2019Quote: ... service pack 3 (Agilent Technologies).
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm column (Agilent), column temperature 50 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... diluted 1:33 in BSA 1% in PBS without Ca2+ and Mg2+for 1h at RT or with negative isotype control mouse IgG2a (cat. X0943 - Agilent Technologies, Santa Clara, CA, USA). Then ...
-
bioRxiv - Neuroscience 2020Quote: ... Free-floating sections were incubated overnight (4 °C) with rabbit anti-GFAP (1:500; DAKO, Z0334). The antibody was prepared in 10% donkey serum in PBS containing 0.02% sodium azide and 0.3% triton X-100 ...
-
bioRxiv - Immunology 2024Quote: ... at 4 °C ON and afterward incubated with rabbit anti-HA antibody 1:2000 (Dako, A0001) 2 h at RT ...
-
bioRxiv - Biophysics 2021Quote: ... 7.8 mm ID x 300 mm column equilibrated in GF150 buffer (25 mM HEPES-KOH, 150 mM KCl, 2 mM MgCl2) plumbed into an HPLC (Agilent 1100). Molecular masses were analyzed by an inline SEC-MALs system (Wyatt Technology ...
-
bioRxiv - Microbiology 2020Quote: ... The SARS-CoV-2 RBD constructs carrying point mutation were generated by following the standard protocol from QuikChange® II XL Kit (Agilent). The cloned genes were sequenced to confirm that no errors had accumulated during the PCR process ...
-
bioRxiv - Cell Biology 2020Quote: ... The cell viability was assessed by measuring the absorbance at 570 nm wavelength using Epoch 2 microplate spectrophotometer (Agilent technologies. USA).
-
bioRxiv - Developmental Biology 2021Quote: ... The single layer supernatant was pipetted into separate 2 mL screw cap amber-glass autosampler vials (Agilent Technologies, Cheadle, United Kingdom); being careful not to break up the solid pellet at the bottom of the tube ...
-
bioRxiv - Neuroscience 2021Quote: ... TUJ1 (Covance) and CMTM5 (custom made by Pineda, Berlin, Germany Table 2) antibodies were diluted in antibody diluent (DAKO, Hamburg, Germany) and incubated for 48 hours at 4°C in a dark ...
-
bioRxiv - Neuroscience 2021Quote: Purpose built rodent specific coils (circular coil 8mm in diameter and height-see [2]) controlled by an arbitrary waveform generator (Agilent 335141B) connected to a bipolar power supply (Kepco BOP 100-4M ...
-
bioRxiv - Genomics 2019Quote: ... fragments with UMIs were generated using 200 ng starting material (purified by ethanol precipitation) in 2 cycles of PCR with Herculase II Fusion DNA Polymerase (Agilent Technologies) using an equimolar mixture of P023poolseqNN-primers (1 mM final concentration ...
-
bioRxiv - Developmental Biology 2019Quote: ... truncated and deletion versions of RAB13 3’UTR were generated by PCR using 0.3 μM sequence-specific primers (Extended Data Table 2) and Platinum Pfx DNA polymerase or using QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) following the manufacturer’s instructions and introduced into the pcDNA3-HBB-24XMS2SL-MCS using the NheI and XhoI sites.
-
bioRxiv - Microbiology 2021Quote: ... The RNA was then cross-linked to positively charged membranes using a UV-crosslinker (Stratagene UV Stratalinker 2400, 2×240 mJoules) and stained with methylene blue (SERVA ...
-
bioRxiv - Systems Biology 2021Quote: ... The staining was performed according to the manufacturer’s procedure with EnVision G|2 Doublestain System Rabbit/Mouse (DAB+/Permanent Red) kit (Dako/Agilent K5361) on the Dako Autostainer ...
-
bioRxiv - Biochemistry 2020Quote: ... Radioactivity was detected using an in-line Lablogic Radiodetector and the analysis was calibrated using a co-injected 2-aminobenzamide-labeled dextran ladder (ProZyme/Agilent) detected on a Dionex fluorescence detector.
-
bioRxiv - Biochemistry 2021Quote: Plasmids encoding AlgE7 variants (Table 2) were constructed based on wild type AlgE7 (plasmid pBG27) (12) using the QuikChange™ Site-directed Mutagenesis Kit (Stratagene/Agilent) or Q5 site directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were further diluted with ultrapure water to a final concentration of 2% HNO3 and subjected to ICP-MS on Agilent 7700 ICP-MS (Agilent Technologies). ICP-MS runs were calibrated with high-purity iron standard solution (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides with PCa tissue samples (n=144) were incubated at 60°C for 2 hours followed by target retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Biochemistry 2022Quote: ... 60 µL of purified PKD1KD at 2 mg/mL was injected onto an S200 10/300 column (Cytiva) connected to a 1260 Infinity HPLC (Agilent Technologies). A MiniDawn Treos (Wyatt ...
-
bioRxiv - Immunology 2021Quote: ... embedded in paraffin, and automatically stained for SARS-CoV-2 (2019-nCoV) Nucleocapsid (SINO BIO, #40143-R019) or for fibrin (DAKO, #A0080) through LEICA BOND RX 1h room- temperature (RT ...
-
bioRxiv - Microbiology 2022Quote: ... and Sialyl-Lewis x (sLex/CD15s) were detected with 2 µg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX-1 (Becton Dickinson ...
-
bioRxiv - Immunology 2020Quote: ... by placing the virus for 2 minutes in a UV Stratalinker 2400 equipped with 365 nm long-wave UV bulbs (Stratagene, USA). UV-inactivation was confirmed by lack of cytopathic effect on BSC-1 cells infected with i-VACV for up to 3 days (data not shown).
-
bioRxiv - Biochemistry 2021Quote: ... was added to a final concentration of 0.5% along with 2 µL of PNGase F Ultra (Agilent Technologies, Santa Clara, CA) and incubated for 1 hour at 37 °C before subsequent 2-AB/2-AA labelling ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples for both the high pressure experiment and ambient pressure control experiment were prepared in 2 mL glass headspace vials (Agilent Technologies) whose caps were pierced with a needle.
-
bioRxiv - Genetics 2021Quote: ... The quality of the DNA was determined by agarose gel electrophoresis and by determining the OD260:OD280 ratio using a Nanodrop spectrophotometer (Epoch 2, Agilent BioTek). De novo genome sequencing was carried out by Novogene (www.novogene.com ...
-
bioRxiv - Neuroscience 2021Quote: The EnVision™ staining kit (G|2 Double-stain System, Rabbit/Mouse, DAB+/Permanent RED code K5361; Agilent technologies, Dako DK) was used for the immunohistochemical stain of Mamu-DR ...
-
bioRxiv - Neuroscience 2021Quote: The EnVision™ staining kit (G|2 Double-stain System, Rabbit/Mouse, DAB+/Permanent RED code K5361; Agilent technologies, Dako DK) was used for the immunohistochemical stain of Mamu-DR ...
-
bioRxiv - Neuroscience 2021Quote: The optimal concentration was determined for each antibody: CD3 (polyclonal rabbit – anti-human CD3 IgG, cat. no. A045201-2, Agilent Technologies), 1:60 ...
-
bioRxiv - Developmental Biology 2021Quote: PSM cells were dissociated on day 2 of differentiation and reseeded onto fibronectin-coated Seahorse plates (Agilent cat. no. 101085-004) at a density of 7 x 105 cells per cm2 in Seahorse XF DMEM (Agilent cat ...
-
bioRxiv - Microbiology 2020Quote: ... Sialyl-Lewis a and Sialyl-Lewis x (sLex also known as CD15s) were detected with 2 μg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX1 (Becton Dickinson ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were enriched with 2 cycles of PCR then assessed for size distribution using the 4200 TapeStation High Sensitivity D1000 ScreenTape (Agilent Technologies) and quantified using the Qubit dsDNA HS Assay Kit (Thermo Fisher) ...
-
bioRxiv - Immunology 2021Quote: ... Antigen retrieval was performed for 15 min in the autoclave (250°F) using 1x Target antigen retrieval solution (Dako; S169984-2). All antibody steps were performed as described above ...
-
bioRxiv - Immunology 2021Quote: ... Slides were then rinsed with double distilled water (ddH2O) and boiled in 1X Dako pH9 antigen retrieval solution (Agilent, S236784-2) for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were then washed in PBS/0.05% Tween 20 and incubated with rabbit anti human VWF (A008229-2, DAKO/Agilent tech) 1/500 or rabbit IgG isotype control (AB-105-C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the absorbance decrease at 340 nm was immediately measured for 2 minutes in a Cary 60 UV-Vis spectrophotometer (Agilent Technologies) at 23 °C to obtain the initial reaction rate of the enzymes (V0) ...
-
bioRxiv - Neuroscience 2022Quote: ... The absorbance of the samples was measured at 540 nm using a Biotek Epoch 2 microplate spectrophotometer (Agilent, Santa Clara, CA). The standard curve of sodium nitrite (0-100 μM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Peptides were re-dissolved in 100 µL solvent A (0.1% TFA in water/ACN (98:2, v/v)) and injected for fractionation by RP-HPLC (Agilent series 1200) connected to a Probot fractionator (LC Packings) ...