Labshake search
Citations for Agilent :
1001 - 1050 of 1583 citations for Tumor necrosis factor receptor superfamily member 3 LTBR Mouse HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: All of the mutations were introduced into a plasmid backbone expressing 6xHis tagged pNL4-3-derived IN by QuikChange site-directed mutagenesis kit (Agilent). The plasmids containing full-length WT and mutants were transformed into BL21 (DE3 ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... LC-MS experiments were carried out on an Agilent 1100 Series LC with a Poroshell 120 EC-C18 column (100 × 3 mm, 2.7 µm, Agilent Technologies) and an Agilent G1956B Series Single Quadripole MS in positive ion mode for mass detection ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were resuspended in FACS staining buffer (3% FBS in PBS) and analyzed by flow cytometry on a Novocyte 3000 (Agilent). Flow cytometry results were analyzed using NovoExpress (version 1.5.6).
-
bioRxiv - Microbiology 2023Quote: ... solution and 3 μl of each sample were subjected to high-resolution liquid chromatography-mass spectrometry (LC-MS) analysis (Agilent iFunnel 6550 quadrupole time-of-flight (QTOF) ...
-
bioRxiv - Microbiology 2023Quote: ... along with gene-specific primers listed in Supplemental Table 3 and qPCR was performed in technical triplicate on a StepOnePlus (Stratagene). Ct values of target genes were normalized to β-actin and relative gene expression levels between conditions were calculated via the ΔΔCt method ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were acidified with trifluoroacetic acid (TFA) to lower the pH below 3 and desalted on reversed phase (RP) C18 OMIX tips (Agilent). The tips were first washed 3 times with 100 µl pre-wash buffer (0.1% TFA in water/acetonitrile (ACN ...
-
bioRxiv - Cell Biology 2023Quote: ... GEMs were used to generate barcoded cDNA libraries following the manufacturer’s protocol (Single Cell 3’ Reagent Kit v3.1, 10X Genomics) and quantified using the TapeStation High Sensitivity D5000 kit (Agilent, Germany). Subsequently ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Microbiology 2023Quote: ... of HIV-1 were amplified by PCR using KOD-Plus-Neo and pNL4-3 as a template and cloned into pBluescript II KS(-) (212208, Agilent). The MLV 5’-LTR (1 - 207 nt ...
-
bioRxiv - Cell Biology 2023Quote: ... then washed 3 × 10minute and post-fixed with 0.1% PFA for 10minutes and mounted using fluorescent mounting medium (DAKO, USA).
-
bioRxiv - Cell Biology 2023Quote: ... the HA epitope sequence was inserted immediately 3’ to the signal peptide sequence by site directed mutagenesis using the QuickchangeXL site directed Mutagenesis kit (Agilent) to obtain the following intermediate vector ...
-
bioRxiv - Physiology 2023Quote: ... The cells were transfected with 100 ng of NF-κB firefly luciferase reporter plasmid p(NF-κB)3-Luc (Stratagene) and 10 ng of Renilla luciferase reporter plasmid pRL-RSV (Promega) ...
-
bioRxiv - Physiology 2023Quote: ... Acetone was measured using an Agilent DB-35MS column (30 m 3 0.25 mm i.d. x 0.25 µm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Molecular Biology 2023Quote: Size Exclusion Chromatography in line with Multi Angle Laser Light Scattering (SEC-MALLS) experiments for absolute mass determination were conducted at 25°C with a BioSEC-3 column (Agilent) equilibrated in 20 mM Na-phosphate pH 7.0 ...
-
bioRxiv - Cell Biology 2023Quote: ... Endogenous peroxidases were blocked by incubation with 3 % H2O2 and then blocked for 1 h (Dako Serum-free protein block). Sections were then incubated with the 1st primary antibody (FABP7 ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were prepared using the QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina (Lexogen) and assessed on a BioAnalyzer 2100 (Agilent) for library quantification and quality control ...
-
bioRxiv - Physiology 2023Quote: ... and 4 μl of supernatant was injected into an HILIC column (HILIC Silica 3 μm, 2.1 × 150 mm, SN: 186002015; Atlantis) on a 1290 Infinity II LC System (Agilent Technologies) which is interfaced with a 6545 MS (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... All sections were washed three times for 3 min with PBS and mounted with Dako Fluorescent Mounting Medium (Agilent, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Synthetic Biology 2024Quote: By acidic methanolysis processed PHB (3-hydroxybutyrate methyl ester) was analyzed by gas chromatography (GC 6850, Agilent Technologies, Basel, Switzerland) equipped with a 7683B Series injector coupled to a flame ionization detector (FID) ...
-
bioRxiv - Microbiology 2020Quote: ... we used for western blot – a goat anti-mouse immunoglobulins HRP conjugated (P0447, Dako, Germany) or anti-rabbit (P0399 ...
-
bioRxiv - Cell Biology 2022Quote: ... Goat anti-mouse and anti-rabbit horseradish peroxidase (HRP)-conjugated antibodies were from Dako (Agilent).
-
bioRxiv - Neuroscience 2021Quote: ... UK) overnight and anti-mouse IgG alkaline phosphatase-linked secondary antibody (1:5,000; Dako, USA). Membranes were incubated with CDP-Star chemiluminescent substrate (Thermo Fisher ...
-
bioRxiv - Immunology 2019Quote: ... staining was developed with the EnVision System-HRP for mouse primary antibodies (Dako, Carpinteria, CA). Sections were counterstained with hematoxylin ...
-
bioRxiv - Genomics 2019Quote: ... and the Flex mouse anti-human CD31 antibody (clone JC70A, Dako North America, Carpinteria, CA) for 90 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary antibodies coupled with horseradish peroxidase (HRP): goat anti-mouse (Dako P0447, WB: 1/1000), goat anti-rabbit (Dako P0448 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Goat anti-mouse polyclonal antibodies conjugated with horseradish peroxidase (cat. #P0447, Agilent, Santa Clara, USA) were used as secondary antibodies.
-
bioRxiv - Immunology 2019Quote: ... Antibodies used for paraffin immunostaining were: rat anti-mouse Ki67 monoclonal antibody (MIB-5, Dako) and rabbit anti-mouse Yap1 antibody (D8H1X ...
-
bioRxiv - Neuroscience 2020Quote: Mouse brains were analyzed as free-floating sections to localize immunoreactivity for GFAP (Z0334, Dako/Agilent ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by a 1:150 dilution of rabbit anti-mouse immunoglobulins (Agilent/Dako, Glostrup, Denmark) for an hour ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by a 1:150 dilution of rabbit anti-mouse immunoglobulins (Agilent/Dako, Glostrup, Denmark) for an hour ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were hybridized to the SurePrint G3 Mouse Gene Expression v2 Microarray (G4852B; Agilent Technologies). Thereafter ...
-
bioRxiv - Microbiology 2020Quote: ... One-color whole mouse (084809_D_F_20150624 slides) 60-mer oligonucleotide 8×60k v2 microarrays (Agilent Technologies) were used to analyze gene expression ...
-
bioRxiv - Microbiology 2021Quote: ... 10 000 RU (response units) of polyclonal anti-mouse antibody (No. Z 0420; Dako, Denmark) or polyclonal anti-human antibody (I2136 ...
-
bioRxiv - Microbiology 2020Quote: ... Sections were washed with TBS-Tween 0.05% for 5 min and rabbit/mouse link (Agilent) was added to slides and incubated for 15 min at room temperature in the dark ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by 1-hour incubation with peroxidase-labeled goat anti-mouse antibodies (1:1000; DAKO) and a 7 min incubation with the True Blue™ (KPL ...
-
bioRxiv - Cell Biology 2020Quote: ... The membranes were incubated with horseradish peroxidase-conjugated goat anti-mouse/rabbit secondary Abs (Dako) for 1h at RT and developed using Immobilon(tm ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were prepared according to Illumina’s instructions and SureSelectXT Mouse All Exon enrichment kits (Agilent) were used ...
-
bioRxiv - Microbiology 2020Quote: ... or chicken anti-GFAP (Abcam, 1:500, or mouse anti-CD68 (Agilent/Dako, 1:200) for 2 hours at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... or chicken anti-GFAP (Abcam, 1:500, or mouse anti-CD68 (Agilent/Dako, 1:200) for 2 hours at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... Specimens were incubated with mouse-anti-SMA primary antibody (Actin Clone 1A4, Dako, Hamburg, Germany) and corresponding biotinylated goat-anti-mouse secondary antibody (Dako ...
-
bioRxiv - Cancer Biology 2020Quote: ... chromogen detection (with HRP polymer, anti-rabbit or anti-mouse, with Envision System from Dako) and hematoxylin counterstaining were performed per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... the following antibodies were used: anti-panCK (mouse, 1:1,000; DAKO, M3515, Clone AE1/AE3), anti-PHH3 (rabbit ...
-
bioRxiv - Cancer Biology 2021Quote: ... Pan-cytokeratin (panCK) was detected by incubating the tissue with anti-panCK antibody (mouse, Agilent, M351501-2 ...
-
bioRxiv - Genetics 2022Quote: ... the DNAs were hybridized on CGH 4 × 180 K mouse slides (AMADID 027411, Agilent Technologies). Finally ...
-
bioRxiv - Physiology 2022Quote: ... Tubulointerstitial cell proliferation was detected by a monoclonal mouse anti-PCNA antibody (Dako, Glostrup, Denmark), while collagen I and fibronectin positivity were detected with polyclonal anti-collagen I (Rockland Immunochemicals ...