Labshake search
Citations for Agilent :
1101 - 1150 of 1583 citations for Tumor necrosis factor receptor superfamily member 3 LTBR Mouse HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2019Quote: ... The microtissues were then washed in PBS (3 × 1 hour) before mounting on glass slides using fluoro-safe mounting media (Dako, S3023). Mounted samples were allowed to cure for 1 day and then imaged using a confocal microscope (Zeiss LSM700 Confocal Microscope).
-
bioRxiv - Cancer Biology 2021Quote: ... Scanning of microarrays was performed with 3 μm resolution (8×60K) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were processed with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were subsequently diluted to adjust the HNO3 concentration to 3 % and ICP-MS was performed with a Hewlett-Packard 4500 ICP mass spectrometer (Agilent Technologies) connected to a CETACASX-500 auto-sampler for sample injection ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA was labeled with Hoechst (1:2000) for 3 min and the sections were mounted using fluorescence mounting media (Dako, S3023). All images were taken using a Zeiss Observer Z1 fluorescent microscope using a 10X objective ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 μm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15□ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR was performed in technical triplicates from at least 3 independent biological samples using the SYBR green Brilliant II fast kit (Agilent Technologies) on an Mx3005p apparatus (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Biochemistry 2023Quote: ... (3) RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Bioengineering 2023Quote: ... PHA was extracted from lyophilized sludge using acidified methanol (3% sulfuric acid) containing chloroform and analyzed using a gas chromatography-mass spectrometry (Agilent, USA). Glycogen in sludge was extracted in a similar way but using 0.9M HCl and analyzed using a liquid chromatography-mass spectrometer (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was cross-linked by exposing the living cells twice to 4,5′,8-trimethylpsoralen at a final concentration of 10 μg/mL followed by 3’ irradiation pulses with UV 365-nm monochromatic light (UV Stratalinker 1800, Agilent Technologies). The cells were then washed repeatedly with cold PBS and lysed with a cell lysis buffer (1.28M sucrose ...
-
bioRxiv - Biophysics 2023Quote: ... The monodisperse sample solutions of proteins were injected onto a size exclusion column (David and Perez 2009) (SEC-3, 150 Å; Agilent) using an Agilent HPLC system and eluted into the capillary cell at a flow rate of 0.3 ml min-1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The slides were then treated with 3% hydrogen peroxide for 10 min and then blocked with Serum-Free Protein Block (Dako, X0909) for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pooled library was quality checked on an Agilent TapeStation System by mixing 3 µL D1000 Sample Buffer (Agilent 5190-6502) with 1 µL pooled library and running in D1000 ScreenTape (Agilent 5067-5582) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and absorbance was measured at 562 nanometers using the Bio-Tek Cytation 3 Multi-Mode Reader (Agilent, Santa Clara, CA, USA). The proteins were run on a 10% SDS-polyacrylamide gel ...
-
bioRxiv - Physiology 2023Quote: ... The metabolic function of activated CD4+ T cells cultured for 3 days in vitro was analyzed by measuring the extracellular acidification rate (ECAR) using an XFe96 extracellular flux analyzer (Seahorse Bioscience). The cells were kept in XF media (Seahorse Bioscience ...
-
bioRxiv - Plant Biology 2024Quote: ... The samples were homogenized and the supernatant was loaded onto a Bond Elut C18 cartridge (100 mg, 3 ml; Agilent Technologies) and eluted with 80% (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... Supernatants were loaded into pre-conditioned Phenomenex Strata XL-100 60 mg/3 ml cartridges (Torrance, CA) and passed through it using positive pressure manifold (Agilent Technologies). Flow through was collected subsequently and 100 µL of filtrate was mixed with 100 µL of water for the LC-MS/MS system ...
-
bioRxiv - Microbiology 2024Quote: ... such as the uncut PT oligos and the four 3-mer release oligos (CCA, CCC, CCG, and CCT) using an HPLC system (Agilent 1290) as outlined below ...
-
bioRxiv - Systems Biology 2020Quote: ... mouse and naked mole rat cells were plated onto a Seahorse XF96 Cell Culture Microplate (Agilent) at a cell density of 105,000 and 80,150 cells per well respectively to allow the cells to be 100% confluent ...
-
bioRxiv - Immunology 2021Quote: ... the membranes were incubated with either HRP-conjugated goat anti-mouse (250 ng/mL; # P0447, Agilent) or HRP-conjugated goat anti-rabbit immunoglobulin (62.5 ng/mL ...
-
bioRxiv - Developmental Biology 2021Quote: ... The secondary antibodies were horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (1:5000, Dako, Japan) and HRP goat anti-rat IgG antibody (Biolegend ...
-
bioRxiv - Microbiology 2019Quote: ... bound Igs were detected with Fluorescein isothiocyanate (FITC)-conjugated rabbit anti-mouse Ig antibody (Dako Cytomation). To quantify total IgG levels ...
-
bioRxiv - Developmental Biology 2021Quote: ... The cRNAs were hybridized on a SurePrint G3 Mouse Gene Expression 8 × 60K Microarray (Agilent Technologies), and fluorescence signals were detected using the SureScan Microarray Scanner (Agilent Technologies) ...
-
bioRxiv - Genomics 2020Quote: ... LECs were washed twice in DPBS and stained with mouse anti-human Ki-67 antibody (Dako) diluted 1:800 in FACS buffer (DPBS with 1mM EDTA and 2% FBS ...
-
bioRxiv - Neuroscience 2019Quote: ... GFAP immunohistochemistry for astrocytes (rabbit anti–mouse GFAP polyclonal antibody 1:13000 for 24 min; DAKO) and IBA-1 for microglia (rabbit polyclonal antibody 1:1000 for 24 min ...
-
bioRxiv - Immunology 2019Quote: ... Calibration beads were stained with F(ab’)2 FITC-Conjugated Goat Anti-Mouse immunoglobulins (Dako, F0479) at 1:50 dilution for 1 hr at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then intracellularly stained with 4G2 mAbs followed by rabbit anti-mouse Igs FITC (Dako). The cells were fixed with 1% formaldehyde and analyzed on BD LSRFortessa ...
-
bioRxiv - Cancer Biology 2021Quote: Whole-exome libraries for all samples were generated using the SureSelect XT Mouse All Exon (Agilent) target enrichment kit with 100 bp paired-end sequencing on the Illumina HiSeq 4000 platform ...
-
bioRxiv - Cancer Biology 2022Quote: We performed immunochemistry assays using mouse anti-human ki67 antibody (M7240, DAKO, 1/200 at pH9) in a series of paraffin-embedded tissue blocks of HGSOC ...
-
bioRxiv - Biochemistry 2022Quote: ... and aSN (primary antibody: anti-Syn-1, BD Transduction Laboratory, secondary antibody: anti-mouse-HRP, Dako). The interaction between endogenous aSN and the endogenous PMCA was studied in the extracts from C57BL/6 mice as described above.
-
bioRxiv - Neuroscience 2022Quote: ... 29] for astrocytes (rabbit anti-GFAP 1:500, Dako, mouse anti-α-tubulin 1:500, Sigma) and microglia (rabbit anti-Iba1 ...
-
bioRxiv - Developmental Biology 2022Quote: Primary antibodies used for staining of hBVOs were mouse anti-hCD31 (dilution 1:100, Dako, M0823), rabbit anti-hPDGFR-β (dilution 1:100 ...
-
bioRxiv - Neuroscience 2020Quote: ... The microarray was performed using the SuperPrint G3 Mouse GE 8×60K Microarray Kit (Agilent, #G4852A) and a DNA microarray scanner ...
-
bioRxiv - Immunology 2021Quote: ... Next day sections were stained using a goat anti-mouse-horseradish peroxidase (HRP)-conjugated antibody (Dako) for BRCA2 and goat anti-rat-HRP-conjugated antibody (Southern Biotech ...
-
bioRxiv - Microbiology 2020Quote: ... followed by incubation with a horseradish peroxidase-labeled anti-mouse IgG (65 ng/ml; Dako, Denmark) diluted in 5% skimmed milk / TBS-Tween (0.1%) ...
-
bioRxiv - Immunology 2020Quote: ... membranes were incubated with secondary Abs (goat anti-rabbit HRP or rabbit anti-mouse HRP; DAKO, Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... the sections were exposed to anti-mouse DAKO EnVision+ System-HRP Labeled Polymer (DAKO, Glostrup, Denmark) for 35 minutes at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG polyclonal antibody was purchased from Dako (Glostrup, Denmark). Super RX X-ray films were obtained from Fujifilm (Tokyo ...
-
bioRxiv - Microbiology 2021Quote: ... After a 30 min incubation with the secondary rabbit-anti mouse IgG antibody (1:25) (Dako) followed a 30 min incubation step with alkaline-phosphatase-anti-alkaline-phosphatase (1:40 ...
-
bioRxiv - Biochemistry 2021Quote: ... Total RNA was examined using the SurePrint G3 Mouse GE 8×60K Microarray (Agilent Technologies, USA.). Data were quantified using the Agilent Feature Extraction software (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 hour incubation at room temperature with secondary antibodies (HRP-conjugated anti-mouse secondary (Dako #P0447); HRP-conjugated anti-rabbit secondary (Dako #P0448) ...
-
bioRxiv - Immunology 2021Quote: ... Secondary antibodies used for Western blotting in this study include: anti-Mouse IgG-HRP (Dako P0447), anti-Rabbit IgG-HRP (Bio-Rad 1706515) ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were incubated with 50 µl Horse Radish Peroxidase (HRP-) conjugated goat anti-mouse antibody (Dako) (1:2000 in PBS-Tween ...