Labshake search
Citations for Agilent :
951 - 1000 of 3899 citations for 6 Quinolinamine 1 ethyl 1 2 3 4 tetrahydro 2 2 4 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... fragments with UMIs were generated using 200 ng starting material (purified by ethanol precipitation) in 2 cycles of PCR with Herculase II Fusion DNA Polymerase (Agilent Technologies) using an equimolar mixture of P023poolseqNN-primers (1 mM final concentration ...
-
bioRxiv - Developmental Biology 2019Quote: ... truncated and deletion versions of RAB13 3’UTR were generated by PCR using 0.3 μM sequence-specific primers (Extended Data Table 2) and Platinum Pfx DNA polymerase or using QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) following the manufacturer’s instructions and introduced into the pcDNA3-HBB-24XMS2SL-MCS using the NheI and XhoI sites.
-
bioRxiv - Microbiology 2021Quote: ... The RNA was then cross-linked to positively charged membranes using a UV-crosslinker (Stratagene UV Stratalinker 2400, 2×240 mJoules) and stained with methylene blue (SERVA ...
-
bioRxiv - Systems Biology 2021Quote: ... The staining was performed according to the manufacturer’s procedure with EnVision G|2 Doublestain System Rabbit/Mouse (DAB+/Permanent Red) kit (Dako/Agilent K5361) on the Dako Autostainer ...
-
bioRxiv - Biochemistry 2020Quote: ... Radioactivity was detected using an in-line Lablogic Radiodetector and the analysis was calibrated using a co-injected 2-aminobenzamide-labeled dextran ladder (ProZyme/Agilent) detected on a Dionex fluorescence detector.
-
bioRxiv - Biochemistry 2021Quote: Plasmids encoding AlgE7 variants (Table 2) were constructed based on wild type AlgE7 (plasmid pBG27) (12) using the QuikChange™ Site-directed Mutagenesis Kit (Stratagene/Agilent) or Q5 site directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were further diluted with ultrapure water to a final concentration of 2% HNO3 and subjected to ICP-MS on Agilent 7700 ICP-MS (Agilent Technologies). ICP-MS runs were calibrated with high-purity iron standard solution (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides with PCa tissue samples (n=144) were incubated at 60°C for 2 hours followed by target retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Biochemistry 2022Quote: ... 60 µL of purified PKD1KD at 2 mg/mL was injected onto an S200 10/300 column (Cytiva) connected to a 1260 Infinity HPLC (Agilent Technologies). A MiniDawn Treos (Wyatt ...
-
bioRxiv - Immunology 2021Quote: ... embedded in paraffin, and automatically stained for SARS-CoV-2 (2019-nCoV) Nucleocapsid (SINO BIO, #40143-R019) or for fibrin (DAKO, #A0080) through LEICA BOND RX 1h room- temperature (RT ...
-
bioRxiv - Microbiology 2022Quote: ... and Sialyl-Lewis x (sLex/CD15s) were detected with 2 µg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX-1 (Becton Dickinson ...
-
bioRxiv - Immunology 2020Quote: ... by placing the virus for 2 minutes in a UV Stratalinker 2400 equipped with 365 nm long-wave UV bulbs (Stratagene, USA). UV-inactivation was confirmed by lack of cytopathic effect on BSC-1 cells infected with i-VACV for up to 3 days (data not shown).
-
bioRxiv - Biochemistry 2021Quote: ... was added to a final concentration of 0.5% along with 2 µL of PNGase F Ultra (Agilent Technologies, Santa Clara, CA) and incubated for 1 hour at 37 °C before subsequent 2-AB/2-AA labelling ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples for both the high pressure experiment and ambient pressure control experiment were prepared in 2 mL glass headspace vials (Agilent Technologies) whose caps were pierced with a needle.
-
bioRxiv - Genetics 2021Quote: ... The quality of the DNA was determined by agarose gel electrophoresis and by determining the OD260:OD280 ratio using a Nanodrop spectrophotometer (Epoch 2, Agilent BioTek). De novo genome sequencing was carried out by Novogene (www.novogene.com ...
-
bioRxiv - Neuroscience 2021Quote: The EnVision™ staining kit (G|2 Double-stain System, Rabbit/Mouse, DAB+/Permanent RED code K5361; Agilent technologies, Dako DK) was used for the immunohistochemical stain of Mamu-DR ...
-
bioRxiv - Neuroscience 2021Quote: The EnVision™ staining kit (G|2 Double-stain System, Rabbit/Mouse, DAB+/Permanent RED code K5361; Agilent technologies, Dako DK) was used for the immunohistochemical stain of Mamu-DR ...
-
bioRxiv - Neuroscience 2021Quote: The optimal concentration was determined for each antibody: CD3 (polyclonal rabbit – anti-human CD3 IgG, cat. no. A045201-2, Agilent Technologies), 1:60 ...
-
bioRxiv - Developmental Biology 2021Quote: PSM cells were dissociated on day 2 of differentiation and reseeded onto fibronectin-coated Seahorse plates (Agilent cat. no. 101085-004) at a density of 7 x 105 cells per cm2 in Seahorse XF DMEM (Agilent cat ...
-
bioRxiv - Microbiology 2020Quote: ... Sialyl-Lewis a and Sialyl-Lewis x (sLex also known as CD15s) were detected with 2 μg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX1 (Becton Dickinson ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were enriched with 2 cycles of PCR then assessed for size distribution using the 4200 TapeStation High Sensitivity D1000 ScreenTape (Agilent Technologies) and quantified using the Qubit dsDNA HS Assay Kit (Thermo Fisher) ...
-
bioRxiv - Immunology 2021Quote: ... Antigen retrieval was performed for 15 min in the autoclave (250°F) using 1x Target antigen retrieval solution (Dako; S169984-2). All antibody steps were performed as described above ...
-
bioRxiv - Immunology 2021Quote: ... Slides were then rinsed with double distilled water (ddH2O) and boiled in 1X Dako pH9 antigen retrieval solution (Agilent, S236784-2) for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were then washed in PBS/0.05% Tween 20 and incubated with rabbit anti human VWF (A008229-2, DAKO/Agilent tech) 1/500 or rabbit IgG isotype control (AB-105-C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the absorbance decrease at 340 nm was immediately measured for 2 minutes in a Cary 60 UV-Vis spectrophotometer (Agilent Technologies) at 23 °C to obtain the initial reaction rate of the enzymes (V0) ...
-
bioRxiv - Neuroscience 2022Quote: ... The absorbance of the samples was measured at 540 nm using a Biotek Epoch 2 microplate spectrophotometer (Agilent, Santa Clara, CA). The standard curve of sodium nitrite (0-100 μM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Peptides were re-dissolved in 100 µL solvent A (0.1% TFA in water/ACN (98:2, v/v)) and injected for fractionation by RP-HPLC (Agilent series 1200) connected to a Probot fractionator (LC Packings) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence was mutagenized to obtain the N-ter tag canonical variant 2 through the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521) using the following DNA primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumor xenograft slides were incubated at 60 °C for 2 h followed by antigen retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Bioengineering 2023Quote: ... Primary (FHL2 2 µg/mL and Ki67 2 µg/mL) and secondary antibodies (same as for in vitro immunofluorescence staining) were diluted in Dako antibody diluent (Dako, Germany). Washing steps were done in Dako washing buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescence spectroscopy measurements of 2 μM of each protein sample were obtained using the Varian Cary Eclipse Fluorescence Spectrophotometer (Agilent Technologies) with an excitation wavelength of 280 nm and recording the emission spectra between 300 nm and 400 nm.
-
bioRxiv - Biochemistry 2023Quote: ... Mutations were introduced into the generated pE-SUMO-α-actinin-2 ABD through site-directed PCR mutagenesis (PfuUltra High-Fidelity DNA Polymerase, Agilent). The following primers were used to introduce cardiomyopathy mutations into the α-actinin-2 ABD sequence.
-
bioRxiv - Microbiology 2023Quote: Site-directed mutagenesis of SARS-CoV-2 spike was performed with the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent 200522), using primers listed in Supplementary table S2 and according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Microbiology 2023Quote: ... into AAATA in the DENV-2 wild type plasmid (pFK-DVs) was generated using QuickChange XL site-directed mutagenesis kit (Agilent, 200517) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... The reaction mixture was incubated for 2 at RT and subsequently applied to a semipreparative RP-HPLC C8 column (Zorbax-300 SB, Agilent, GE) connected to an HPLC system (Agilent 1260 ...
-
bioRxiv - Immunology 2023Quote: ... Endogenous peroxidase was blocked using Peroxidase block (Refine Kit) followed by Protein block (X090930-2, Agilent Technologies Inc., Santa Clara, CA). Primary antibodies were applied at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Biochemistry 2023Quote: Mutations were generated by site-directed mutagenesis (table 2) on this plasmid using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and plasmids were verified through sequencing through the Molecular Informatics Core at the University of Rhode Island.
-
bioRxiv - Microbiology 2023Quote: ... strains carrying the empty plasmid pME6032 or pME6032 harboring natT or natR copies were grown ON in LB supplemented with Tet 100 μg/ml and then diluted to an OD 0.05 with fresh LB supplemented with different concentrations of IPTG (0 - 250 μM) and grown in microtiter plates in an Epoch-2 reader (Agilent Technologies). 20 mM NAM was supplemented where indicated.
-
bioRxiv - Microbiology 2024Quote: ... Cultures were grown at 30 °C in 96-well plates in an BioTek Epoch 2 shaking incubator (Agilent, Santa Clara, CA) for 72 hours.
-
bioRxiv - Cancer Biology 2024Quote: Sections from primary tumors and the matched axillary node with the largest metastatic focus (≥ 2 mm) were used for assessment of nerves (Neurofilament antibody, DAKO M0762), and angiogenesis markers (Factor-VIII ...
-
bioRxiv - Microbiology 2024Quote: ... approximately 2 μg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 μm, 300Å, 1x75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 μl/min (solvent A ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were incubated overnight at 4° C with primary antibodies (mouse-anti-Ataxin-3, 1:2500, clone 1H9, MAB5360, MerckMillipore, Darmstadt, Germany; rabbit-anti-Ubiquitin, 1:500, Z0458, Dako, Jena, Germany). After washing the membranes were incubated with secondary antibodies (peroxidase affinePure donkey anti-mouse IgG H+L ...
-
bioRxiv - Cancer Biology 2022Quote: ... fixed tissues were embedded in paraffin and 4 mm sections were histologically processed for hematoxylin-eosin staining and immunohistochemistry using anti-human Ki67 antibody (DAKO #M7240, 1:75, 30 min at 37°C). All these procedures were performed using standardized protocols by Atrys Health S.A.
-
bioRxiv - Cancer Biology 2021Quote: ... the membranes were washed 3X with TBST followed by incubation with HRP-conjugated secondary antibodies (Rabbit Cytiva/Amersham NA934; Mouse Agilent/Dako P026002-2) for one hour at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: Immunofluorescence microscopy was performed on de-paraffinized tissue sections that received heat-induced antigen retrieval using Target Retrieval Solution (Agilent Dako, S169984-2). After washing and permeabilization in TBS-T universal buffer (0.2% Triton X-100 in tris-buffered saline) ...
-
bioRxiv - Cell Biology 2019Quote: ... Sections were then treated with Proteinase K (20 μg/mL) for 15 minutes for antigen retrieval and blocked with DAKO background reducing protein blocking agent (Agilent, X090930-2) prior to 1 hour incubation of CD206 (1:200 ...
-
bioRxiv - Biophysics 2021Quote: ... The cell suspension was then centrifuged at 8000 RPM for 2 minutes and the supernatant was collected and measured using a fluorescence spectrophotometer (Agilent Cary Eclipse). Using a similar measurement without the RBCs ...
-
bioRxiv - Neuroscience 2020Quote: CLC-2 mutants were generated by site-directed mutagenesis using a QuickChange XL Site-Directed Mutagenesis Kit (Agilent Technologies, Cedar Creek, TX). The following table lists primers used to generate expression vectors in this study.