Labshake search
Citations for Agilent :
901 - 950 of 3899 citations for 6 Quinolinamine 1 ethyl 1 2 3 4 tetrahydro 2 2 4 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Slides were then washed in PBS/0.05% Tween 20 and incubated with rabbit anti human VWF (A008229-2, DAKO/Agilent tech) 1/500 or rabbit IgG isotype control (AB-105-C ...
-
bioRxiv - Microbiology 2022Quote: The tandem mass spectrometer was hyphenated to a liquid chromatography set-up comprising 2 binary pumps (1290 series, Agilent technologies). For each experiment ...
-
bioRxiv - Molecular Biology 2022Quote: ... live cell imaging lines were generated using a U-2 OS cell line harboring a Flp-In site and stably expressing a ponasterone A inducible system (Agilent), a gift from Robert Singer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μl of each purified final library was run on an Agilent TapeStation HS D1000 ScreenTape (Agilent Technologies, 5067-5584). The libraries were quantified using the Quant-iT 1X dsDNA HS kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... Peptides were desalted as previously described (32) using an OT-2 liquid handling robot (Opentrons Labworks Inc.) mounted with Omix C18 pipette tips (A5700310K; Agilent). Desalted peptides were dried and stored at −80 °C prior to re-suspension in 3.0 % (v/v ...
-
bioRxiv - Neuroscience 2022Quote: Adeno-associated viral (AAV) vector serotype 2 was prepared using an AAV Helper-Free system (Agilent Technologies, Santa Clara, CA) as described previously (Kato et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the integrity and size distribution of the RNA was assessed using mRNA Nano series 2 assay (G2938, Agilent Technologies).
-
bioRxiv - Immunology 2022Quote: ... SARS-COV-2-Strunc variants were generated in house by site-directed mutagenesis (QuikChange Multi Site-Directed Mutagenesis Kit, Agilent) starting from synthetic DNA (Genscript) ...
-
bioRxiv - Cell Biology 2023Quote: ... vector containing the SARS-CoV-2 HA-ORF3a gene was used in site-directed mutagenesis using a QuikChange II site-directed mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... was purchased from Jackson ImmunoResearch Laboratories and was used for Western blotting. Affinity-purified rabbit polyclonal anti-human lambda-light chain (cat. A019302-2) was purchased from Dako and was used for Western blotting ...
-
bioRxiv - Microbiology 2023Quote: ... HCT-8 cells or HCT-8 AhR KO cells were plated at 2 x 104 cells per well in a 96-well Seahorse XF96 cell culture microplate (Agilent) and grown for ∼24h ...
-
bioRxiv - Neuroscience 2023Quote: AAV was produced by HHMI-Janelia Viral Tools using a PEI triple transfection protocol into AAV293T cells (an ITR-containing plasmid, 2/9 capsid helper from UPenn Vector Core, and the E1-deleted pHelper plasmid from Agilent). The cells were grown under serum-free conditions (three 150mm culture dishes at ∼3×107 cells/dish for each 100 µl batch) ...
-
bioRxiv - Microbiology 2023Quote: ... were prepared and stained with hematoxylin eosin (HE) for histological examination or subjected to immunohistological staining to detect SARS-CoV-2 antigen (performed in an autostainer; Agilent), using the horseradish peroxidase (HRP ...
-
bioRxiv - Plant Biology 2023Quote: ... and 2 µg DNase-treated RNA was reverse transcribed using a cDNA Synthesis Kit (Agilent Technologies, Santa Clara, CA, USA), following the respective manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 100 µl of purified proteins at ∼2 mg/ml concentration were injected onto a Superdex 200 Increase 10/300 column (Cytiva) on an HPLC (Agilent) connected to miniDAWN TREOS and Optilab T-rEX detectors (Wyatt Technology) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... An aliquot of 200 µL from each sample was separated and diluted to 2 mL of 2% v/v HNO3 and analysed for Sr content via inductively coupled plasma mass spectrometry (ICP-MS; Agilent 8800 ICP-QQQ ...
-
bioRxiv - Genomics 2023Quote: ... OD600 measurements were performed at 30°C every 15 min until a plateau was reached in a BioTek Epoch 2 Microplate Spectrophotometer (Agilent).
-
bioRxiv - Plant Biology 2024Quote: ... Peptides were desalted as previously described (60) using an OT-2 liquid handling robot (Opentrons Labworks Inc.) mounted with Omix C18 pipette tips (A5700310K; Agilent). Desalted peptides were dried and stored at - 80°C prior to re-suspension in 3.0% (v/v ...
-
bioRxiv - Neuroscience 2023Quote: ... the incubation time for oligomycin during the assay was increased to 15 min to allow for proper diffusion into the slices and the final toxin concentrations were increased to 5 μM for oligomycin and 2 μM for rotenone/antimycin (Agilent). The ATP production was normalised to the FO slice protein content as measured by Nanodrop (Implen).
-
bioRxiv - Microbiology 2023Quote: ... Culture plates were incubated at 37°C for 22 hrs and kept anaerobic during the OD600 measurement in a Synergy 2 Plate Reader (Biotek Agilent Technologies Deutschland GmbH ...
-
bioRxiv - Cancer Biology 2023Quote: ... was performed using the Exome Cancer Test v2.0 (EXaCT-2) assay that was developed with Agilent based on SureSelect Human All Exon V6 (Agilent Technologies) (manuscript in preparation) ...
-
bioRxiv - Cancer Biology 2024Quote: Paraffin-embedded human HCC samples were cut into 3.5-µm thick tissue sections and processed for immunohistochemistry with the EnVision FLEX kit material (K800021-2, Agilent Dako) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Oxygen consumption rate of U2OS WT and G3BP1/2 dKO cells was measured on an extracellular flux analyzer (Agilent Seahorse) using the XF Cell Mito Stress Test Kit following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Molecular Biology 2023Quote: ... On day 2 the XF Real-Time ATP Rate Assay Kit (Cat. No. 103592-100, Agilent Technologies, Cedar Creek, TX) was run following the manufacturer’s protocol using the Seahorse XF96 Analyzer as described above.
-
bioRxiv - Plant Biology 2023Quote: ... acetonitrile and 2 µl was injected for the analysis with LC/MS (6520 Accurate-Mass Q-TOF connected to Agilent 1100 Series HPLC ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.2% Triton X-100 and incubation with appropriate secondary antibody for 2 hr at room temperature in blocking buffer before washing and mounting in fluorescent mounting medium (DAKO). Images were acquired using a Leica SP8 confocal microscope ...
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype: rabbit immunoglobulin fraction, DAKO). Alexa labeled secondary antibodies (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 µm tissue sections were stained and developed using AutostainerPlus (Dako). Antibodies were diluted in block solution and sections were incubated for 30 minutes with primary antibody and 20 minutes with secondary antibodies ...
-
bioRxiv - Synthetic Biology 2020Quote: ... or Streptococcus pneumoniae β-N-Acetylhexosaminidase (Prozyme, 4 mU per digest) overnight at 37°C in 20 mM sodium acetate (pH 5.0).
-
bioRxiv - Cancer Biology 2019Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step DNA was purified by Ampure XP beads (Beckmann Coulter Genomics #A63882) ...
-
bioRxiv - Cancer Biology 2019Quote: Whole Human Genome Microarray Kit 4×44K (Agilent, Cat. No. G4112F) was used to detect mRNA expression levels in cells transfected with control and miR-101-3p transfected HCT116 cells ...
-
bioRxiv - Cell Biology 2021Quote: ... overnight at 4°C after blocking with blocking solution (S3022, Dako) for 30 min ...
-
bioRxiv - Cell Biology 2019Quote: ... Each SBC mouse (4*180K) LncRNA microarray slide (Agilent Technologies Inc.) was hybridized with 1.65 μg Cy3-labeled cRNA using a gene expression hybridization kit (Agilent Technologies ...
-
bioRxiv - Immunology 2019Quote: ... and then overnight at 4°C in rabbit anti-CD3 (Dako) in 1% (v/v ...
-
bioRxiv - Genetics 2020Quote: ... at 4°C followed by secondary antibody (Dako Cytomation, Glostrup, Denmark) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... using the Canis (V2) Gene Expression Microarray 4×44K (Agilent Technologies). Microarray data were subjected to gene ontology (GO ...
-
bioRxiv - Immunology 2022Quote: ... overnight at 4°C in Dako REAL antibody diluent (Dako, S2022). To visualized the specific signal ...
-
bioRxiv - Genomics 2023Quote: ... elegans (V2) Gene Expression Microarray 4 × 44k chips were used (Agilent). Scanning was done with an Agilent High Resolution C Scanner ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step ...
-
bioRxiv - Biochemistry 2023Quote: ... Absorbance was measured using a BioTek Synergy 4 plate reader (Agilent).
-
bioRxiv - Biophysics 2021Quote: ... 7.8 mm ID x 300 mm column equilibrated in GF150 buffer (25 mM HEPES-KOH, 150 mM KCl, 2 mM MgCl2) plumbed into an HPLC (Agilent 1100). Molecular masses were analyzed by an inline SEC-MALs system (Wyatt Technology ...
-
bioRxiv - Microbiology 2020Quote: ... The SARS-CoV-2 RBD constructs carrying point mutation were generated by following the standard protocol from QuikChange® II XL Kit (Agilent). The cloned genes were sequenced to confirm that no errors had accumulated during the PCR process ...
-
bioRxiv - Cell Biology 2020Quote: ... The cell viability was assessed by measuring the absorbance at 570 nm wavelength using Epoch 2 microplate spectrophotometer (Agilent technologies. USA).
-
bioRxiv - Developmental Biology 2021Quote: ... The single layer supernatant was pipetted into separate 2 mL screw cap amber-glass autosampler vials (Agilent Technologies, Cheadle, United Kingdom); being careful not to break up the solid pellet at the bottom of the tube ...
-
bioRxiv - Neuroscience 2021Quote: ... TUJ1 (Covance) and CMTM5 (custom made by Pineda, Berlin, Germany Table 2) antibodies were diluted in antibody diluent (DAKO, Hamburg, Germany) and incubated for 48 hours at 4°C in a dark ...
-
bioRxiv - Neuroscience 2021Quote: Purpose built rodent specific coils (circular coil 8mm in diameter and height-see [2]) controlled by an arbitrary waveform generator (Agilent 335141B) connected to a bipolar power supply (Kepco BOP 100-4M ...