Labshake search
Citations for Agilent :
51 - 100 of 522 citations for 3 Acetyl N ethylpyridinium bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct ...
-
bioRxiv - Cell Biology 2022Quote: ... Data analysis: PNGase F released free N-glycan was identified by Agilent Masshunter Quantitative Analysis software by the presence of hexose and N-acetylhexosamine ...
-
bioRxiv - Physiology 2024Quote: ... fitted with a 150 µL glass insert (Agilent, P/N 5183-2088) and closed with a Teflon-lined septum cap (Agilent ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Biochemistry 2022Quote: ... Samples were first treated by non-denaturing release overnight with N-glycanase (Prozyme) at 37°C and ...
-
bioRxiv - Microbiology 2024Quote: ... on an Agilent 6890 N gas chromatograph (Agilent Technologies, Inc., Santa Clara, CA) as described previously [28 ...
-
bioRxiv - Physiology 2024Quote: ... and closed with a Teflon-lined septum cap (Agilent, P/N 5191-8160). Whole body liquid extraction was performed in a solution consisting of 90 µL of hexane and 10 µL of 10 mg/mL hexacosane (Millipore Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-diaminobenzidine (DAB) solution (Dako, USA) until signal was detected ...
-
bioRxiv - Cancer Biology 2022Quote: ... and KI67 (clone TEC-3, Dako) were then incubated on the tissue slices and bound antibody was detected with biotinylated goat anti-rat IgG (Southern Biotechnology) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-diaminobenzidine tetrahydrochloride (DAB; Dako, K3467), as chromogen ...
-
bioRxiv - Biochemistry 2023Quote: ... or a BIOSEC 3 column (Agilent; flow rate ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ diaminobenzidine (DAB) (Dako, Carpinteria, CA) and counter-staining was done with hematoxylin ...
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...
-
bioRxiv - Biochemistry 2021Quote: ... N-terminally His6-tagged KRAS was expressed in BL21-CodonPlus(DE3)-RIL cells (Stratagene) by isopropyl-β-D-1-thiogalactopyranoside induction at 18 °C ...
-
bioRxiv - Biophysics 2022Quote: TRPV4 N-terminal constructs were expressed in Escherichia coli BL21-Gold(DE3) (Agilent Technologies) grown in terrific broth (TB ...
-
bioRxiv - Biophysics 2024Quote: ... All mutations and N-terminal epitope tags were added using Pfu Turbo polymerase (Agilent). Primers are listed in Supplemental Table 1 ...
-
bioRxiv - Bioengineering 2024Quote: ... Purified mAbs were fluorescently labeled with GlykoPrep Rapid N-Glycan kit (ProZyme, Hayward, CA), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
Machine learning and data-driven inverse modeling of metabolomics unveil key process of active agingbioRxiv - Systems Biology 2024Quote: ... Gas separation was performed on the HP-5MS column (30 m 3 0.25 mm 3 0.25 mm, Agilent Technologies).
-
bioRxiv - Evolutionary Biology 2022Quote: ... Samples were inserted into a GC (Agilent 6890 N; Agilent Technologies, Santa Clara, CA, USA) by a MultiPurpose Sampler (MPS ...
-
bioRxiv - Biochemistry 2020Quote: The N-glycan analysis was performed on a 1260 Infinity liquid chromatography system (Agilent Technologies) coupled to a 6560 IM-QTOF mass spectrometer (Agilent Technologies ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Volatile compounds were analyzed using a 6890 N gas chromatograph (Agilent Technologies, Santa Clara, CA) with a DB5ms (60m ...
-
bioRxiv - Genomics 2024Quote: ... Fragment length was measured on Femto Pulse system (Agilent, CA, United States, Cat N° M5330AA) using the Genomic DNA 165 kb Ladder Fast Separation assay with a separation time of 70 min (Agilent ...
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Immunology 2020Quote: ... and isotype control: Glycans were prepared using the GlykoPrep® Rapid N-Glycan Preparation kit (PROzyme) and separated by Hydrophilic-Interaction Liquid Chromatography (HILIC ...
-
bioRxiv - Cancer Biology 2023Quote: ... N-Universal Negative Control Anti-Rabbit or Anti-Mouse (IS600 and IS750, respectively, Dako, Glostrup, Denmark) was used ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... (3) CD8 (Cytotoxic T Cells, 1:400, M7103; Dako)–Opal 570 ...
-
bioRxiv - Biochemistry 2020Quote: Skd3 variants were expressed as an N-terminally MBP-tagged protein in BL21 (DE3) RIL cells (Agilent). Cells were lysed via sonication in 40mM HEPES-KOH pH=7.4 ...
-
bioRxiv - Biochemistry 2022Quote: ... PARLSkd3 and variants were expressed with an N-terminal MBP-tag in BL21 (DE3) RIL cells (Agilent). Cells were lysed via sonication in lysis buffer (40 mM HEPES-KOH pH = 7.4 ...