Labshake search
Citations for Agilent :
1 - 50 of 522 citations for 3 Acetyl N ethylpyridinium bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... N-acetyl-PABA (NAPABA) was measured using high performance liquid chromatography (Agilent 1100 HPLC Series) as described elsewhere(Butcher et al ...
-
bioRxiv - Immunology 2024Quote: ... Hepta-N-acetyl Chitoheptaose (Cat. no.# 57/11-0010) were analyzed with TSK-Gel (Cat. no.# G2000SWx.) on HPLC (Agilent Technologies 1260 Infinity). The change in refractive index was observed over time for different samples ...
-
bioRxiv - Microbiology 2023Quote: ... HT29 SGG UCN34 (n=3) were checked on RNA 6000 Nano chips (Bioanalyzer, Agilent) for quality and integrity ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Microbiology 2020Quote: Two different glycosidases were used for specific removal of N-glycans: peptide N-glycosidase F (PNGase F) and endo N-glycosidase H (Endo H) (Prozyme, Hayward, CA). PNGase F removes all N-glycans from gp120/41 glycoprotein whereas Endo H removes high-mannose and hybrid glycans ...
-
bioRxiv - Pathology 2020Quote: ... Cambridge, MA), CD68 (LV n=25, IVS n= 26, RV n=22) for macrophages (1:800, clone KP1, Dako/Agilent, Santa Clara, CA), and CD163 (LV n=26 ...
-
bioRxiv - Pathology 2020Quote: ... Abcam, Cambridge, MA), CD68 (LV n=25, IVS n= 26, RV n=22) for macrophages (1:800, clone KP1, Dako/Agilent, Santa Clara, CA), and CD163 (LV n=26 ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Biophysics 2022Quote: ... a N-STORM 647 nm laser (Agilent), an iXon 897 Ultra EMCCD (Andor Technologies) ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 7.4 (Agilent, cat. n. 103575-100). The assay medium only was used as a blank in one well coated with dH2O and one well with Cell-Tak.
-
bioRxiv - Bioengineering 2023Quote: ... 4.6 × 300mm (Agilent, P/N: PL1580-5301) SEC column connected to Agilent 1260 Bioinert Infinity Quaternary Pump System (Pump serial# DEAGH00678) ...
-
bioRxiv - Microbiology 2020Quote: ... The extracted fatty acids were derivatized with pentafluorobenzyl bromide (PFB) and analyzed in the negative ion mode by gas chromatography-mass spectrometry (GC-MS/MS Agilent HP7890B/7000C). The gas chromatograph was performed at the Functional Lipidomics platform ...
-
bioRxiv - Neuroscience 2020Quote: ... Cat N° R37605) for 20 min and coverslips were mounted with Fluorescence Mounting Medium (Dako, Glostrup, Denmark, Cat N° S3023), while wells in the device were sealed with one drop of mounting medium per well before acquiring images ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2022Quote: ... 5 μm column (Agilent p/n 993967-902). For the HPLC ...
-
bioRxiv - Bioengineering 2024Quote: ... Fatty acids from each fraction were analyzed as their methyl esters after a direct transesterification with acetyl chloride/methanol on a 7890B gas chromatograph coupled to a 5977A Mass Selective Detector (Agilent Technologies, USA) equipped with a capillary column (J&W Select FAME CP7420 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Biochemistry 2023Quote: ... 800 µL sample and MTBSTFA (100 µL, N-tert-butyldimethylsilyl)-N-methyltrifluoroacetamide) were transferred to amber capped glass vials (Agilent Technologies, USA), heated to 80 °C for 20 min ...
-
bioRxiv - Plant Biology 2024Quote: ... dissolved in 15 µl pyridine and derivatized with 30 µl N-methyl-N-(trimethylsilyl)trifluoracetamid (MSTFA) before being analyzed by GC-MS (Agilent 7890B GC-Agilent 5977N-MSD) as previously described (Berghoff et al. ...
-
bioRxiv - Biochemistry 2022Quote: Offline N-glycan analysis was done using AdvanceBio Gly-X N-glycan prep with InstantPC (GX96-IPC, Agilent Technologies, Santa Clara, CA) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: Offline N-glycan analysis was done using AdvanceBio Gly-X N-glycan prep with InstantPC (GX96-IPC, Agilent Technologies, Santa Clara, CA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... or flurometric (citrate, acetyl-CoA) assays (cat. no. KA1674, ab102516, KA3791 and MAK039, respectively) and a microplate reader (BioTek Synergy Neo2, Agilent, Santa Clara, CA) according to manufacturer’s instructions (Abnova ...
-
bioRxiv - Bioengineering 2023Quote: ... and n-caprylate by an Agilent 7890B GC (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... consisting of a model 6890 N gas chromatograph (Agilent).
-
bioRxiv - Cancer Biology 2023Quote: ... anti-IgL (Clone: N/A; 1:400; Agilent; #GA507), and anti-IgK (Clone ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen-antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with hematoxylin (Dako ...
-
bioRxiv - Physiology 2022Quote: ... Antigen–antibody complexes were revealed with 3-3′- diaminobenzidine (K346811, Dako) or the DAB (Polymer ...
-
bioRxiv - Cell Biology 2024Quote: ... at 1:500 and 3-3’-diamino-benzidine-tetrahydrochloride (Dako, K3468). Stained sections were imaged using an NanoZoomer 2.0HT (Hamamatsu).
-
bioRxiv - Cancer Biology 2024Quote: ... Antigen–antibody complexes were reveled with 3-3′-diaminobenzidine (K346811, Agilent). Sections were counterstained with hematoxylin (CS700 ...
-
bioRxiv - Microbiology 2022Quote: ... HRP-labelled goat anti-mouse immunoglobulin (cat. n° P0447, Dako). The following antibodies were used for flow cytometry ...
-
bioRxiv - Cancer Biology 2023Quote: ... and anti-IgK (Clone: N/A; 1:4000; Agilent; #A0191). Optimization of the antibodies and staining conditions was carried out on sections of human tonsil ...
-
bioRxiv - Microbiology 2021Quote: ... Tissue sections were colored via DAB-staining (3, 3-diaminobenzidine; Dako, K3468).
-
bioRxiv - Plant Biology 2024Quote: ... dissolved in 15 µl pyridine and derivatized with 30 µl N-methyl-N-(trimethylsilyl)trifluoracetamid (MSTFA) before being analyzed by GC-MS (Agilent 7890B GC-Agilent 5977N-MSD) as previously described (Berghoff et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-Diaminobenzidine (DAB, Agilent) and then counterstained with haematoxylin (Abcam) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... or Streptococcus pneumoniae β-N-Acetylhexosaminidase (Prozyme, 4 mU per digest) overnight at 37°C in 20 mM sodium acetate (pH 5.0).
-
bioRxiv - Cancer Biology 2020Quote: ... Immunostaining was detected using 3,3’-diaminobenzidine (Agilent Dako, Cat # N-1939) peroxidase chromogen substrate ...
-
bioRxiv - Cancer Biology 2020Quote: ... Immunostaining was detected using 3,3’-diaminobenzidine (Agilent Dako, Cat # N-1939) peroxidase chromogen substrate ...
-
bioRxiv - Cell Biology 2021Quote: ... The N-terminal region was removed by a Quikchange reaction (Agilent), and the resulting shortened fragment was inserted into the pDEST-HisMBP destination vector via a Gateway reaction.
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies (SARS-CoV2-N, Genetex GTX635679, 1:200; KRT7, Agilent Dako M701829-2 ...
-
bioRxiv - Microbiology 2022Quote: ... HRP-labelled goat anti-mouse immunoglobulin (IgG; cat. n° P0447, Dako). The following antibodies were used for flow cytometry ...
-
bioRxiv - Cancer Biology 2023Quote: ... in 3 cycles for 3 hours using the Seahorse XFe24 analyzer system (Agilent Technologies). Inhibitors and substrates were used at the following concentrations ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm column (Agilent), column temperature 50 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were coverslipped using Di-N-Butyle Phthalate in xylene (DPX, Dako).
-
bioRxiv - Microbiology 2020Quote: ... 0.4μg of M and 0.8μg of N) using GeneJammer transfection reagent (Agilent). Medium was replaced 16h post-transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by O/N incubation of primary antibody (GFAP (1:500, Dako) in 2% BSA ...
-
bioRxiv - Neuroscience 2021Quote: ... and the quality of the libraries were performed on a 2100 Bioanalyzer from Agilent using an Agilent High Sensitivity DNA kit (Agilent P/N 5067-4626). Sequencing libraries were loaded at 10 to 12pM on an Illumina HiSeq2500 with 2 × 50 paired-end kits using the following read length ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies (SARS-CoV2-N, Genetex GTX635679, 1:200; KRT7, Agilent Dako M701829-2 ...