Labshake search
Citations for Agilent :
51 - 100 of 638 citations for 3 Trifluoromethylthio benzeneboronic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... for amino acids and an Eclipse Plus C18 (1.8 μm; Agilent) for TCA and PPP intermediates ...
-
bioRxiv - Microbiology 2021Quote: ... The fatty acid profiles were analyzed by gas chromatography (Agilent 7890A) using the RTSBA6 method/library ...
-
bioRxiv - Genetics 2021Quote: ... and organic acids by a dual-wavelength absorbance detector (Agilent G1314F).
-
bioRxiv - Physiology 2021Quote: Amino acid concentrations were determined with high-performance liquid chromatography (Agilent Technologies 1100 HPLC System ...
-
bioRxiv - Microbiology 2021Quote: ... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
bioRxiv - Neuroscience 2022Quote: ... Anti glial fibrillary acid protein (Abcam, GFAP, Dako Z0334 1:1000); Anti CD68 (Biorad MCA1957 ...
-
bioRxiv - Neuroscience 2022Quote: ... and glial fibrillary acid protein (GFAP; Z0334, Dako, RRID:AB_10013382, 1:500) were performed as previously described (Muñoz-Manchado et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... Silica beads functionalized with phenyl-boronic acid (Bondesil-PBA 40µm, Agilent) were used for glycopeptides enrichment at an optimized ratio of 1:2.5 sample:PBA beads w/w ...
-
bioRxiv - Immunology 2024Quote: Extracellular acid ratio was determined by Seahorse Flux Analyzer XF96 (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The long chain fatty acid oxidation stress test (Agilent, 103672-100) was performed to measure oxygen consumption rates (OCR ...
-
bioRxiv - Plant Biology 2023Quote: ... Lipid bands were scratched from the plates and their fatty acids extracted (fatty acid methyl esters FAMEs) and quantified by GC-MS (Agilent 7890 A and MSD 5975 Agilent EI) as in (39) ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
Machine learning and data-driven inverse modeling of metabolomics unveil key process of active agingbioRxiv - Systems Biology 2024Quote: ... Gas separation was performed on the HP-5MS column (30 m 3 0.25 mm 3 0.25 mm, Agilent Technologies).
-
bioRxiv - Plant Biology 2020Quote: The contents of celastrol and wilforic acid A were analyzed by Agilent 1260LC-6400 QQQ (triple quadrupole mass) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using a telomere PNA (peptide nucleic acid) FISH Kit/FITC (DAKO, Denmark) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... The Long-Chain Fatty Acid Substrate Oxidation kit (Agilent cat #103672-100) was utilized to probe differences in OCR upon injection with either vehicle (media only ...
-
bioRxiv - Cancer Biology 2022Quote: ... The matrix employed was α-cyanohydroxycinnamic acid obtained in solution from Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... Resin acid identification and quantification were performed by capillary GC (Agilent 7890A). Helium ...
-
bioRxiv - Microbiology 2023Quote: ... Amino acid analysis was performed by high-pressure liquid chromatography (HPLC) (Agilent 1100 ...
-
bioRxiv - Biophysics 2022Quote: ... Amino acid analysis was performed on an Agilent 1260 HPLC (Agilent Technologies) equipped with a fluorescence detector using automated o-phtalaldehyde/2-mercaptopropionic acid (OPA/MPA ...
-
bioRxiv - Microbiology 2024Quote: ... Fatty acids were identified with a mass spectrometer (Agilent 5977B GC/MSD) according to the comparison of retention times of commercial fatty acid standards (Supelco 37) ...
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the concentration of various organic acids were measured by HPLC (Agilent, 1260 Infinity), using a standard analytical system (Shimadzu ...
-
bioRxiv - Plant Biology 2022Quote: ... whereas the amino acids were quantified using an HPLC system (Agilent 1100; Agilent) equipped with a Zorbax Eclipse Plus C18 column (4.6 mm × 150 mm ...
-
bioRxiv - Physiology 2022Quote: Free fatty acid composition was evaluated by GC-MS (Agilent technology GC7890-MS5975). Briefly ...
-
bioRxiv - Plant Biology 2022Quote: ... whereas the amino acids were quantified using an HPLC system (Agilent 1100; Agilent) equipped with a Zorbax Eclipse Plus C18 column (4.6 mm × 150 mm ...
-
bioRxiv - Cell Biology 2020Quote: ... fatty acid oxidation was assessed by using the Seahorse XF24 Analyzer (Agilent Technologies) to measure mitochondrial respiration ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the fatty acids were dosed from the autosampler of a GC (Agilent 7890A) as pulses to the front inlet packed with the catalyst bed (maintained in the range 250-400 °C) ...
-
bioRxiv - Microbiology 2020Quote: ... Amino acid analysis was performed by HPLC (Agilent 1100; Agilent Technologies, Massy, France) with a guard cartridge and a reverse phase C18 column (Zorbax Eclipse-AAA 3.5 μm ...
-
bioRxiv - Molecular Biology 2021Quote: ... Library quality was confirmed using the Agilent 2200 TapeStation Nucleic Acids System (Agilent).
-
bioRxiv - Molecular Biology 2022Quote: ... and 2.5 µM medronic acid (5191-4506, Agilent Technologies, Santa Clara, CA, USA). The LC gradient was ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The quality of nucleic acids was assessed with a Fragment Analyzer (Agilent, Switzerland) at the Lausanne Genomic Technologies Facility of the University of Lausanne.
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...