Labshake search
Citations for Agilent :
851 - 900 of 1131 citations for tert Butyl trans 17 bromo 4 7 10 13 tetraoxa 15 heptadecenoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... onto a DB-5MS column (30 m × 0.25 mm, film thickness 0.25 µm; including 10 m DuraGuard column, Agilent). The inlet liner was changed after every 50 samples when processing porewater extracts and after 100 samples when processing seagrass tissues to avoid damage to the GC column ...
-
bioRxiv - Biochemistry 2020Quote: ... AGP-1 containing fractions were pooled and concentrated by spin concentrators (10 kDa cut off) (Agilent Technologies, USA). The concentrate was then applied to a DEAE-cellulose column (25 × 0.5 cm ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were then transformed into XL-10 Gold chemically competent Escherichia coli cells (Agilent Technologies, Santa Carla, CA) as previously described [14] ...
-
bioRxiv - Cell Biology 2020Quote: ... Quenching of endogenous peroxidase was performed by a 10 min incubation with Peroxidase-Blocking Solution (Dako REAL S2023). Blocking was done in M.O.M ...
-
bioRxiv - Synthetic Biology 2020Quote: ... A 1 μL aliquot of the sample was injected into a VF-5ms capillary column (30 m × 250 μm i.d., 0.25 μm film thickness) with a 10 m EZ-Guard column (Agilent). The injection temperature was 250 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 μl of a protein sample at 8.5-10 mg/ml was injected to a BioSEC3-300 (Agilent) or Superdex 75 10/300 GL increase column (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... After deparaffinization, antigens were activated (121°C, 10 min) with Target Retrieval Solution pH6.0 (Dako Cytomation, Glostrup, Denmark), and endogenous HRP was inactivated by hydroperoxide treatment ...
-
bioRxiv - Genomics 2021Quote: ... and confirmed RNA integrity via gel electrophoresis and Fragment Analyzer (RQN: 8.4- 10; Agilent Technologies, Inc, CA, USA). We standardized samples to 75 ng RNA for library preparation input ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were deparaffinized by incubation at 60°C for 10 min and incubated with PT-Link (Dako, Agilent) for 20 min at 95°C in low pH to detect VDR ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were deparaffinized by incubation at 60°C for 10 min and incubated with PT-Link (Dako, Agilent) for 20 min at 95°C in low pH to detect VDR ...
-
bioRxiv - Bioengineering 2022Quote: ... Samples of labeled and unlabeled antibody (5 – 10 μg) were run on a HPLC (Agilent 1260 Infinity II) using an Agilent AdvanceBIO SEC 300Å 2.7 mm column (PL1580-3301 ...
-
bioRxiv - Cancer Biology 2024Quote: ... At this stage 10% of wells were checked using an Agilent 2100 Bioanalyzer (Agilent Inc., Santa Clara, California) to determine whether products of appropriate size were produced ...
-
bioRxiv - Cancer Biology 2024Quote: ... Antigen retrieval was then performed at 97 °C for 10 minutes with Target Retrieval Solution (Agilent, S236784-2) on a PT Module (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... diluted in PBS for 10 min at RT and accordingly mounted using DAKO fluorescent mounting medium (DAKO; S3023). Zeiss Axio Imager Z1 was used to image the samples ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Some of them were subjected to further purification using semipreparative techniques (Agilent, C18, 5 μm, 250 × 10 mm) using appropriately selected aqueous AcN or MeOH solvent systems.
-
bioRxiv - Microbiology 2024Quote: ... 10-µl reactions were prepared with the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent) in technical duplicates for each sample ...
-
bioRxiv - Plant Biology 2022Quote: ... All samples were loaded into a 10 cm capillary column packed with 5 μM Zorbax SB-C18 (Agilent) and then connected to a 5 cm-long strong cationic exchange (SCX ...
-
bioRxiv - Physiology 2022Quote: ... were placed in 50 µl XF medium (non-buffered DMEM containing 10 mM glucose and 2 mM GlutaMax, pH 7.3-7.4, Agilent), centrifuged in a carrier tray (300g for 3 min with no break) ...
-
bioRxiv - Microbiology 2022Quote: ... injection volume 5-10 μL and data was collected in centroid mode with Mass Hunter Workstation software (Agilent). Raw Agilent.d files were converted to mzXML with MSconvert and analysed using the Maven software package (84) ...
-
bioRxiv - Molecular Biology 2023Quote: ... We checked the quality of the RNA (RQN = 10) using a Fragment Analyzer (Agilent, United States of America).
-
bioRxiv - Immunology 2023Quote: ... the primary polyclonal rabbit anti-human/mouse fibrin(ogen) (10 μg/mL in HBSS, Agilent Dako, Glostrup, DK) antibody was added overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... the primary polyclonal rabbit anti-human/mouse fibrin(ogen) (10 μg/mL in HBSS, Agilent Dako, Glostrup, DK) antibody was added overnight at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... A total of 10 ng of the reconstituted oligos was utilized for PCR amplification (Agilent Cat No. 600679). Two PCR reactions were carried out ...
-
bioRxiv - Bioengineering 2024Quote: ... samples were treated with 0.3% Sudan black solution for 10 min prior to blocking for 2 h (Dako Blocking Solution X0909 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The signal evolution was tracked in regular intervals for 45min on the confocal Cytation 10 instrument (Agilent Technologies) using the 60x magnification objective and the filters/LED cubes for DAPI ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies diluted in blocking solution were incubated overnight at 4°C (anti-GFAP z0334 DAKO 1:400, anti-Iba1 019-19741 Wako 1:400). After three washes in PBS ...
-
bioRxiv - Physiology 2020Quote: ... blocked with 3% BSA in PBS1 and incubated overnight at 4°C with primary polyclonal antibodies for glucagon and insulin (Dako, Agilent, Santa Clara, CA, USA) (Table S8) ...
-
bioRxiv - Microbiology 2020Quote: ... Sample quality control was assessed using a Qubit 4 Fluorometer (using Qubit™ dsDNA BR assay Kit) and Agilent 2200 TapeStation (using Agilent D5000 ScreenTape assay kit). Library construction and sequencing was undertaken at Novogene (Beijing ...
-
bioRxiv - Cancer Biology 2022Quote: ... explants treated with BrdU substrate for 24 hours prior to fixation as described in Section 6.3.1) (DAKO, Cat. M0744; 1:50 overnight at 4 °C), cytokeratin (DAKO ...
-
bioRxiv - Biophysics 2021Quote: ... Mutations were introduced through site-directed mutagenesis (QuikChange II XL, with 10 XL Gold cells; Agilent Technologies, Kista, Sweden) and confirmed by sequencing at the Linköping University Core Facility.
-
bioRxiv - Microbiology 2021Quote: Vortexed 10 kDa-filtered plasma samples (about 135 µL) were transferred in a 0.5 mL 96-well plate (Agilent) and mixed on thermoshaker Eppendorf (1.5 min ...
-
bioRxiv - Biochemistry 2022Quote: ... 50 μl of each protein sample at 8.5-10 mg/ml was injected onto a BioSEC3-300 column (Agilent) at a 0.2 ml/min flow rate ...
-
bioRxiv - Neuroscience 2021Quote: ... Deparaffinized sections and free-floating brain slices were incubated for 10-30 min in Target Retrieval Solution (S1700; Dako) at 72-102 °C in a water-bath for antigen retrieval20 ...
-
bioRxiv - Bioengineering 2021Quote: ... samples were subjected to a treatment with 0.3% Sudan black solution for 10 min prior to blocking for 2 h (Dako Blocking Solution X0909 ...
-
bioRxiv - Neuroscience 2020Quote: ... incubated with DAPI (1:10’000) to label nuclei for 10 min and mounted using Fluorescence mounting medium (Dako, S3023). Fluorescent images were recorded with a Leica SP5 Confocal Microscope.
-
bioRxiv - Cell Biology 2021Quote: ... FACS sorted MPs were plated on XF96 cell culture microplates coated with 10% Matrigel in warm assay medium (Agilent), the cell culture plate was centrifuged with 200 g for 5 min ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBS and 10% Methanol for 10 min and incubated overnight with the primary antibody (Table 2) in PBS/T 0.1 with 10 % normal swine/ goat or rabbit serum (Dako). Second ...
-
bioRxiv - Molecular Biology 2021Quote: ... In TTBS rinsed slides were blocked for 10 min at room temperature using DAKO peroxidase blocking solution (#S200230, Dako), washed again in TTBS ...
-
bioRxiv - Cell Biology 2020Quote: ... The desalted large peptide mixture was separated by a home-packed PLRP column (PLRP-S, 200 mm length x 500 μm i.d., 10 μm particle size, 1,000 Å pore size, Agilent) in a 63-min gradient from 10% to 90% mobile phase B (mobile phase A ...
-
bioRxiv - Bioengineering 2020Quote: ... VO2max = 1.04×10−16 mol/s/cell was measured for hiPSC-Heps using the Seahorse XF24 cellular respirometer (Agilent) (see ...
-
bioRxiv - Immunology 2021Quote: ... for 10 minutes at 37°C for F4/80 or blocked with a protein block (catalog number x0909, Dako) for 10 minutes followed by an Fc block (catalog number 553142 ...
-
bioRxiv - Biochemistry 2022Quote: ... The gas chromatograph was equipped with a DB-5 ms column (30 m × 0.25 mm, film thickness 0.25 μm; including 10 m DuraGuard column, Agilent Technologies) and a GC inlet liner (ultra inert ...
-
bioRxiv - Immunology 2022Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). Basal OCR and ECAR were measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were washed with PBS 1X for 10 mins and coverslipped with Dako fluorescence mounting medium (Dako North America).
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding the single-mutation variants found in P.1 and 10-mutation variant (BZΔ10) were generated by Quikchange II XL site-directed mutagenesis kit (Agilent). Recombinant Indiana VSV (rVSV ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and equipped with a VF-5ms column (30 m × 0.25 mm × 0.25 μm, with 10 m EZ-guard column, J&W Agilent Technologies). For the analysis of CHCs ...
-
bioRxiv - Genomics 2020Quote: ... The coverslips were incubated with 10 μL mixture of a custom probe set targeting a selected DNA locus (Agilent) and SureFISH Hybridization Buffer (Agilent ...
-
bioRxiv - Immunology 2020Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). OCR was measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL template DNA and 10 μL Brilliant III Ultra-Fast QPCR Master Mix (Agilent Technologies, Santa Clara, CA). PCR was conducted with a Stratagene Mx3005P (Agilent technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... was ligated into pCMV6-AC-HIS vector following incorporation of flanking restriction enzyme sites by PCR (SgfI AGGCGATCGCCATGAGCTGGGTGCAGGTCAACTT, MluI – GCGACGCGTACTTTGCCCCTGCTGCTGCTCTG) and grown in XL-10 Gold E.Coli (Agilent). Site directed mutagenesis (Q5-SDM – NEB ...