Labshake search
Citations for Agilent :
8651 - 8700 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... and by capillary electrophoresis on a 2100 Bioanalyzer (Agilent).
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries had been quantified using the Bioanalyzer (Agilent), and were sequenced with Illumina NovaSeq6000 S4 (2x150bp ...
-
bioRxiv - Cancer Biology 2023Quote: ... was measured using Bioanalyzer (Agilent). Sequencing libraries were prepared with KAPA stranded RNA-Seq Kit with RiboErase (Kapa Biosystems ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Mutations were introduced into the FFA4 sequence using the QuikChange method (Stratagene), and in all cases the presence of the mutation was verified through sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... Concentration of RNA extracts was determined using a spectrophotometer (Implen) and integrity evaluated using a 2100 BioAnalyzer (Agilent). For long term storage ...
-
bioRxiv - Plant Biology 2023Quote: ... Ethylene production was measured by gas chromatography (Shimadzu GC-2010 equipped with HP-PLOT ‘S’ Al2O3 50m,0.53mm column (Agilent Technologies) as described in (Mandal and Sinharoy ...
-
bioRxiv - Plant Biology 2023Quote: ... The library was quantitated with Qubit and run on a Fragment Analyzer (Agilent, Santa Clara, CA, USA) to confirm the presence of DNA fragments of the expected size ...
-
bioRxiv - Plant Biology 2023Quote: ... Peptides were dissolved in loading solvent A (0.1% TFA in water/ACN (98:2, v/v)) and desalted on a reversed-phase (RP) C18 OMIX tip (Agilent, Santa Clara, USA). The tip was first washed 3 times with 100 μl pre-wash buffer (0.1% TFA in water/ ACN (20:80 ...
-
bioRxiv - Plant Biology 2023Quote: ... then a 120 µm DVB/CWR/PDMS fibre (Agilent) was exposed to the headspace of a given sample for 15 min (also at 60 °C).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Labelled radioactive peptide was separated from unlabeled peptide by HPLC purification (Agilent ZORBAX 300 Extend-C18 column) using a gradient from 20-50% acetonitrile (+0.1 % TFA ...
-
bioRxiv - Pathology 2023Quote: ... A BioTek Synergy H1 plate reader (Agilent) with Gen5 software (Agilent ...
-
bioRxiv - Pathology 2023Quote: ... followed by another 30 min room temperature incubation with streptavidin/horseradish peroxidase (1:300, P0397, Agilent). Staining was obtained by using an alcohol-soluble peroxidase substrate ...
-
bioRxiv - Bioengineering 2023Quote: ... the RNA integrity was evaluated on an Agilent 2100 Bioanalyzer by using the RNA 6000 Pico kit (Agilent). cDNA library preparation ...
-
bioRxiv - Bioengineering 2023Quote: Amplicons were concentrated by QIAquick gel extraction kit and estimated by Bioanalyzer (Agilent). The NGS sequence library was created by ligating illumina universal sequence adapter with the barcode for MISeq paired 300 bp reads (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... Quality and integrity of the RNA was evaluated using the Agilent RNA 600 pico kit (Agilent Technologies) and RNA samples were stored at -80°C until further processing ...
-
bioRxiv - Immunology 2023Quote: ... PCR products of enhancers were amplified in a mix of PfuUltra DNA Polymerase (600385-51, Agilent Technologies, Santa Clara, CA) and Taq DNA polymerase (M7123 ...
-
bioRxiv - Microbiology 2023Quote: Binding of VHHs to spike proteins on the surface of mammalian cells was determined by flow cytometry using pcG1-expression plasmids containing the coding sequence of the SARS-CoV-2 spike protein from which the C-terminal 18 amino acids were deleted and in which the D614G substitution was introduced by QuickChange site-directed mutagenesis (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA of the reference pool were then hybridized together on customized microarray chip using commercially available hybridization platform (Agilent) for 20 h at 70 °C with rotation at 10 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: ... The quality of RNA was evaluated using the Agilent 2100 Bioanalyzer with Agilent RNA 6000 Nano Kit (Agilent Technologies, 5067-1511). Libraries were prepared using the Illumina TruSeq Stranded Total RNA kit with ribosomal depletion by Ribo-Zero Gold solution from Illumina according to the manufacturer’s protocol and sequenced on an Illumina HiSeq 4000 (2× 75 bp).
-
bioRxiv - Bioengineering 2023Quote: ... The qualities of RNA-seq libraries were verified using the Tape Station D1000 assay (Tape Station 2200, Agilent Technologies) and the concentration of RNA-seq libraries were checked again using real time PCR (QuantStudio 6 Flex Real time PCR System ...
-
bioRxiv - Cell Biology 2023Quote: ... Acceptable RNA quality was confirmed by capillary electrophoresis on an Agilent 2100 bioanalyzer (Agilent, Santa Clara, CA, USA). Gene expression profiling was performed using arrays of the mouse MoGene 2.0 type ...
-
bioRxiv - Developmental Biology 2023Quote: ... The quality and quantity of the total RNA were assessed using a Bioanalyzer 2100 (Agilent Technologies). Samples with an RNA integrity number (RIN ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA integrity was validated using a Bioanalyzer 2100 (Agilent, RRID:SCR_019715). Total RNA was treated with DNase and reverse transcribed using the Maxima First Strand cDNA synthesis kit with ds DNase (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2023Quote: ... Mutations were introduced using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) and confirmed by DNA sequencing.
-
bioRxiv - Biophysics 2023Quote: ... coli BL21-ArcticExpress (DE3)-RIL competent cells (Agilent Technologies, Santa Clara, CA, USA) in Terrific Broth modified medium (Melford ...
-
bioRxiv - Biochemistry 2023Quote: ... The average results of each element’s concentration were calculated for triplicate or duplicate measurements using MassHunter 4.1 Workstation Software for 7700 ICP-MS (Agilent Technologies Inc. 2015).
-
bioRxiv - Biochemistry 2023Quote: ... and filtered through a 0.22 μm PVDF filter before the ICP-MS analysis (7700 Series, Agilent Technologies, Santa Clara, CA, USA). The system was calibrated with 0 ...
-
bioRxiv - Biochemistry 2023Quote: ... QuikChange (Agilent Technologies, Germany) mutagenesis of the bicistronic plasmid was carried out with a sense (5’ CAGCCCCGAAGGCCGCTGCAGCGGCGGCCCCAGTCAAGTCACCGT 3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... The TEV eluates were incubated for 1 h with prewashed calmodulin sepharose beads (Agilent Technologies) and washed with lysis buffer containing 2 mM CaCl2 ...
-
bioRxiv - Biochemistry 2023Quote: NMR spectra were obtained at 600 MHz (Agilent, Coldprobe) and 800 MHz (Bruker Avance III ...
-
bioRxiv - Biochemistry 2023Quote: Total protein concentration of purified individual nanoparticle components was determined by measuring absorbance at 280 nm using a UV/vis spectrophotometer (Agilent Cary 3500 Multicell) and calculated extinction coefficients65 ...
-
bioRxiv - Biochemistry 2023Quote: ... and coupled to Agilent Infinity II 1260/1290 UPLC (Agilent Technologies) and an ESI source of timsTOF Pro equipped with PASEF (Bruker Daltonics) ...
-
bioRxiv - Biochemistry 2023Quote: ... Site-directed mutation was performed using the QuikChange II XL kit (Agilent). Pairs of oligonucleotides F_XAC2609-E48A/R_XAC2609-E48A ...
-
bioRxiv - Biochemistry 2023Quote: ... The mutations were incorporated in WT pfrkip DNA sequence using QuikChange XL site-directed mutagenesis kit (Stratagene, USA) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Biochemistry 2023Quote: ... The purified peptide binders and target peptides were titrated in the presence of Nano-Glo substrate in 96-well plates and the luminescence was measured on a Synergy Neo2 plate reader (Agilent). To conduct the fluorescence polarization binding assays ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescence polarization measurements were performed at 25°C in a Synergy Neo2 plate reader (Agilent) with a 530/590nm filter ...
-
bioRxiv - Biochemistry 2023Quote: ... Fractionation was carried out on an AssayMAP Bravo Sample Prep Platform (Agilent), using the Fractionation v1.1 Protocol in the Protein Sample Prep Workbench v3.2.0 with standard settings ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl C18 Cartridges (Agilent) were used as solid phase ...
-
bioRxiv - Biochemistry 2023Quote: ... or D266K) were made through site-directed mutagenesis using the PfuUltra High-Fidelity DNA polymerase (Agilent, cat# 600380). Chimeric mNG-PIP5K ...
-
bioRxiv - Biochemistry 2023Quote: ... through integration of extracted ion chromatograms (EIC) corresponding to products (P) and substrates (S) (Agilent ChemStation) and normalized according to equation: Multiple products were observed for Axl substrates Syn A ...
-
bioRxiv - Biochemistry 2023Quote: ... Sample aliquots (50 µL) were run on HPLC (Agilent 1200 series) using a C18 Agilent Zorbax column (2.1 x 250mm ...
-
DTX3L and USP28 fine-tune DNA double strand repair through mutual regulation of their protein levelsbioRxiv - Biochemistry 2023Quote: ... anti-mouse (Dako P044701-2; 1:1000) Alexa Fluor 488 or anti-rabbit (#1706515 ...
-
bioRxiv - Cancer Biology 2023Quote: ... To obtain the 28s rRNA signal the RNA samples were subjected to electrophoresis on a chip (ScreenTapes) using TapeStation 4200 (Agilent) according to manufacturer instructions.
-
bioRxiv - Cell Biology 2023Quote: ... The total RNA quality and quantity were analysis of Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent, CA, USA) with RIN number >7.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... CrysAlisPRO (Oxford Diffraction / Agilent Technologies UK Ltd, Yarnton, England) and Aimless [66] (Table 2).
-
bioRxiv - Biochemistry 2023Quote: ... QuikChange® Site-Directed Mutagenesis Kit was procured from Stratagene, USA.
-
bioRxiv - Neuroscience 2023Quote: ... and quality-assessed by Genomic DNA ScreenTape (#5067-5365, Agilent Technologies) with a 4150 TapeStation analyzer (#G2992AA ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... RNA integrity was assayed using an RNA Pico chip on a Bioanalyzer 2100 (Agilent, Santa Clara, CA), and only samples with RIN > 9 were considered for subsequent analyses ...
-
bioRxiv - Cancer Biology 2023Quote: ... pH 9 (Agilent, S2367) for 15 minutes ...