Labshake search
Citations for Agilent :
8501 - 8550 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... and filtered through a 0.22 μm PVDF filter before the ICP-MS analysis (7700 Series, Agilent Technologies, Santa Clara, CA, USA). The system was calibrated with 0 ...
-
bioRxiv - Biochemistry 2023Quote: ... QuikChange (Agilent Technologies, Germany) mutagenesis of the bicistronic plasmid was carried out with a sense (5’ CAGCCCCGAAGGCCGCTGCAGCGGCGGCCCCAGTCAAGTCACCGT 3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... The TEV eluates were incubated for 1 h with prewashed calmodulin sepharose beads (Agilent Technologies) and washed with lysis buffer containing 2 mM CaCl2 ...
-
bioRxiv - Biochemistry 2023Quote: NMR spectra were obtained at 600 MHz (Agilent, Coldprobe) and 800 MHz (Bruker Avance III ...
-
bioRxiv - Biochemistry 2023Quote: Total protein concentration of purified individual nanoparticle components was determined by measuring absorbance at 280 nm using a UV/vis spectrophotometer (Agilent Cary 3500 Multicell) and calculated extinction coefficients65 ...
-
bioRxiv - Cell Biology 2023Quote: ... equipped with a monolithic laser combiner (MLC400, Agilent) containing solid-state lasers of wavelengths 405 nm (at 100 mW of maximum fibre output power) ...
-
bioRxiv - Cell Biology 2023Quote: ... After placing an islet capture screen by a Seahorse Capture Screen Insert Tool (Agilent) into the well ...
-
bioRxiv - Cell Biology 2023Quote: ... Polymicro Technologies) was installed in a CE/MS cassette (cat. G1603A, Agilent) on the CE system (Agilent Technologies 7100) ...
-
bioRxiv - Cell Biology 2023Quote: ... A total of 20 μl of re-dissolved solution was then loaded into an injection vial (cat. 9301-0978, Agilent; equipped with a snap cap (cat. 5042-6491, Agilent)) ...
-
bioRxiv - Cell Biology 2023Quote: ... The parameters of mass spectrometer (Agilent Technologies 6545) were set as ...
-
bioRxiv - Cell Biology 2023Quote: ... Data were collected using Wave 2.6.3 Desktop software (Agilent) and exported to Prism 9 (GraphPad ...
-
bioRxiv - Cell Biology 2023Quote: ... XF96 Extracellular Flux Analyzer Prep Station (Agilent) at 37 °C for 1 h ...
-
bioRxiv - Cell Biology 2023Quote: ... OCR was then measured at 37 °C in an XF96 Extracellular Flux Analyzer (Agilent), with a Seahorse XFe96 sensor cartridge (Agilent ...
-
bioRxiv - Cell Biology 2023Quote: ... Data were collected using Wave 2.6.1 Desktop software (Agilent) and exported to Prism 9 (GraphPad ...
-
bioRxiv - Cell Biology 2023Quote: ... with a Seahorse XFe24 sensor cartridge (Agilent) pre-equilibrated in Seahorse XF Calibrant solution (Seahorse Bioscience ...
-
bioRxiv - Cancer Biology 2023Quote: ... tissues were incubated with secondary antibodies (EnVision Chem Detection Kit, DaKo Cytomation) at room temperature for 30 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quality control of the final libraries was completed on the Agilent 2100 Bioanalyzer using the High Sensitivity DNA Kit (Agilent, 5067-4626) to determine the average library sizes ...
-
bioRxiv - Cancer Biology 2023Quote: ... Bioanalyzer2100 RNA Nano 6000 chips (Agilent, Cat. 5067-1511) were used to assess RNA quality ...
-
bioRxiv - Biochemistry 2023Quote: ... Amplified DNA was subcloned with StrataClone Blunt PCR cloning kit (Agilent Technologies, 240207) and sequenced with M13 Forward ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 (DE3) pLysS cells (Agilent). Cultures were grown at 37 °C in LB containing 34 μg/mL chloramphenicol ...
-
bioRxiv - Biochemistry 2023Quote: ... The light source of the RI detector was a G1315B DAD UV detector (Agilent) and wavelength of the laser in the light scattering instrument was set at 658.9 nm ...
-
bioRxiv - Bioengineering 2023Quote: ... cells and tissues were mounted with fluorescent mounting medium (Dako). Images were captured with a Nikon Eclipse 600 fluorescent microscope or with Leica TCS SP5 Laser Scanning Confocal microscope ...
-
bioRxiv - Bioengineering 2023Quote: ... Gen5 software (Agilent/BioTek) was utilized to fully automate image acquisition ...
-
bioRxiv - Bioengineering 2023Quote: Cellular segmentation and high-content analysis was performed as part of the fully automated imaging protocol described above with the Gen5 software (Agilent BioTek). Individual cells were assessed for a number of intensity- and geometry-based metrics ...
-
bioRxiv - Bioengineering 2023Quote: ... the packaging plasmid (see above) and pHelper (Agilent) for the three adenoviral helper genes ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21-CodonPlus (DE3)-RIPL cells (Agilent, CA, USA, #230280) transformed with the pET28a-based FLAG-Topbp1 expression plasmid by the addition of 0.5 mM IPTG in Terrific broth for 16 h at 25°C ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant adenoviruses were produced using the AdEasy XL Adenoviral Vector System (Agilent Technologies) and purified using the AdEasy Virus Purification Kit (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2023Quote: ... Reversed-phase separation was performed using a 50 cm analytical column (in-house packed with Poroshell 120 EC-C18, 2.7 µm, Agilent Technologies) with a 180 min gradient ...
-
bioRxiv - Bioengineering 2023Quote: ... the sections were stained with a DAB detection kit (Dako, Copenhagen, Denmark) and hematoxylin ...
-
bioRxiv - Bioengineering 2023Quote: ... and analyzed by FlowJo 10 (TreeStar, USA) or NovoExpress (Agilent, Technologies, USA).
-
bioRxiv - Biochemistry 2023Quote: PdLCry mutants were generated by QuikChange (Agilent) site-directed mutagenesis and verified by sequencing ...
-
bioRxiv - Biochemistry 2023Quote: ... specimens were mounted in Agilent Dako mounting medium (Agilent Dako; No. S3023). Images were acquired with Leica DMI6000B fluorescence microscope equipped with DFC360FX CCD camera ...
-
bioRxiv - Biochemistry 2023Quote: The AtSWEET1 (At1g24300) mutants were generated via QuickChange site-directed mutagenesis (Agilent) in pDONR-AtSWEET1 vectors ...
-
bioRxiv - Biochemistry 2023Quote: ... or site-directed mutagenesis (Agilent) and (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... and coupled to Agilent Infinity II 1260/1290 UPLC (Agilent Technologies) and an ESI source of timsTOF Pro equipped with PASEF (Bruker Daltonics) ...
-
bioRxiv - Biochemistry 2023Quote: ... Site-directed mutation was performed using the QuikChange II XL kit (Agilent). Pairs of oligonucleotides F_XAC2609-E48A/R_XAC2609-E48A ...
-
bioRxiv - Biochemistry 2023Quote: ... The mutations were incorporated in WT pfrkip DNA sequence using QuikChange XL site-directed mutagenesis kit (Stratagene, USA) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Biochemistry 2023Quote: ... The purified peptide binders and target peptides were titrated in the presence of Nano-Glo substrate in 96-well plates and the luminescence was measured on a Synergy Neo2 plate reader (Agilent). To conduct the fluorescence polarization binding assays ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescence polarization measurements were performed at 25°C in a Synergy Neo2 plate reader (Agilent) with a 530/590nm filter ...
-
bioRxiv - Biochemistry 2023Quote: ... Fractionation was carried out on an AssayMAP Bravo Sample Prep Platform (Agilent), using the Fractionation v1.1 Protocol in the Protein Sample Prep Workbench v3.2.0 with standard settings ...
-
bioRxiv - Cancer Biology 2023Quote: ... 23 RIN values were determined using an Agilent 2100 Bioanalyzer (Agilent Technologies, Foster City, CA) and only those with values of >8.5 were processed further ...
-
bioRxiv - Genetics 2023Quote: ... The genomic DNA quality and quantity were evaluated using a Femto Pulse (Agilent) and a Qbit 3.0 (Invitrogen ...
-
DTX3L and USP28 fine-tune DNA double strand repair through mutual regulation of their protein levelsbioRxiv - Biochemistry 2023Quote: ... anti-mouse (Dako P044701-2; 1:1000) Alexa Fluor 488 or anti-rabbit (#1706515 ...
-
bioRxiv - Cancer Biology 2023Quote: ... To obtain the 28s rRNA signal the RNA samples were subjected to electrophoresis on a chip (ScreenTapes) using TapeStation 4200 (Agilent) according to manufacturer instructions.
-
bioRxiv - Cell Biology 2023Quote: ... The total RNA quality and quantity were analysis of Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent, CA, USA) with RIN number >7.0 ...
-
bioRxiv - Bioengineering 2023Quote: High-performance liquid chromatography (HPLC) (Shimadzu Co.) with an ion exchange column (Agilent Hi-Plex Column) was employed to detect the metabolites of first part of pathway and the final product ...
-
bioRxiv - Bioengineering 2023Quote: ... mouse monoclonal anti-human CD31 (Agilent, clone DAKO JC70A), mouse monoclonal anti-HLA class II-DR/DP/DQ (Abcam ...
-
bioRxiv - Bioengineering 2023Quote: All kinetic data were obtained using either a BioTek Synergy H1 or Cytation 5 plate reader (Agilent Technologies). HEX was measured with an excitation peak of 533 nm and an emission peak of 559 nm with a gain of 80 to 100 to ensure fluorescence values were within the linear range of detection ...
-
bioRxiv - Bioengineering 2023Quote: ... and quality was measured using the Bioanalyzer 2100 Eukaryote Total RNA Nano assay (Agilent Technologies, CA, USA). Libraries were prepared using the QIAseq miRNA Library Kit (Qiagen ...