Labshake search
Citations for Agilent :
8051 - 8100 of 9205 citations for Mouse Autophagy related protein 16 1 ATG16L1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: Point substitutions within RBD in SARS-CoV-2 spike gene were introduced by site-directed mutagenesis using the QuikChange II kit (Agilent Technologies Inc.) following the manufacturer’s protocol and by overlapping PCR strategy as described previously (Patil et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Whole-exome sequencing libraries were prepared using SureSelectXT Human All Exon V5 + UTR kit (75 Mb; Agilent technologies, Santa Clara, CA, USA) as per manufacturer’s instructions and sequenced on HiSeq 2000 to generate paired end 2 × 100bp sequence reads (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: ... was derived from pcDNA-V5-hWls (EVI/WLS-V5, Belenkaya et al, 2008) using the QuikChange II Site-Directed Mutagenesis Kits (200523, Agilent Technologies Inc.) according to the manufacturer’s instructions and the primers CGGAACATCAGTGGGAGGCAGTCCAGCCTGCCAGCTATGAGCAGAGTCCGGCGGC and GCCGCCGGACTCTGCTCATAGCTGGCAGGCTGGACTGCCTCCCACTGATGTTCCG ...
-
bioRxiv - Microbiology 2020Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies; Santa Clara, CA, USA). RNA sequencing libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (New England BioLabs ...
-
bioRxiv - Cell Biology 2020Quote: ... E706A/E1015A and E437A/E706A/E1015A=EallA) were obtained by site-directed mutagenesis of pCS2-3×HA-NFATc3 using the QuickChange® II XL kit (Agilent Technologies) using the indicated primers ...
-
bioRxiv - Immunology 2021Quote: ... and quality control was performed on the Agilent 2100 Bioanalyzer with the High Sensitivity DNA Kit (Cat. No. 5067-4626; Agilent, Waldbronn, Germany). Mixed libraries were sequenced on a NextSeq550 with 2 × 75 bp paired-end reads.
-
bioRxiv - Genomics 2021Quote: ... and RNA integrity was determined with an RNA ScreenTape Kit on the TapeStation 2200 system (Agilent, 5067-5576, 5067-5578, 5067-5577). cDNA libraries were prepared using the KAPA Stranded mRNA-Seq Kit (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... The purity and content of total RNA were quantified using Bioanalyzer 2100 Spectrophotometers and RNA 1000 Nano LabChip Kit (Agilent, CA, USA). Total RNA was used for subsequent experiments if the total RNA samples met the following criteria ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA integrity and quantitation were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Library preparation and sequencing were performed by Novogene Co ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... RNA integrity and quantitation were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). A total amount of 1 μg RNA per sample was used as input material for the RNA sample preparations ...
-
bioRxiv - Cancer Biology 2022Quote: ... The size of the collected DNA fragments was determined using a 2100 Bioanalyzer and the High Sensitivity DNA Kit (Agilent Technologies, Inc.). Libraries were run in the Rapid Run flow cell and sequenced with paired-end sequencing (2×76 bp ...
-
bioRxiv - Neuroscience 2022Quote: ... Rat GluN2B-G689C-C1/2 and Rat GluN2B-G689S-C1/2 were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent,Cat. # 200518). Primers for GluN2B-G689C Mutagenesis ...
-
bioRxiv - Neuroscience 2022Quote: ... were used for each replicate and placed into 100 μL of lysis buffer + β-mercaptoethanol from the Absolutely RNA Microprep kit (Agilent Technologies). Each genotype was prepared in quadruplicate ...
-
bioRxiv - Physiology 2022Quote: ... extracellular acidification rate (ECAR) and other bioenergetic parameters were measured using the Agilent Seahorse XFp Mito stress test kit (Agilent, 103010-100). Baseline and stressed OCR and ECAR were determined prior and post-injection of stressor compounds ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA integrity and quantitation were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). A total amount of 1 μg RNA per sample was used as input material for the RNA sample preparations ...
-
bioRxiv - Physiology 2024Quote: ... for assessment of the RNA integrity by the RNA 6000 Nano Chip Kit with the Agilent 2100 Bioanalyzer (Agilent Technologies, Waldbronn, Germany), and samples with RIN number above 7.5 were used for micro-array analysis ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... Probes produced from PCR templates were radiolabelled with [α-32P]-dCTP (Hartmann Analytic, #SRP-305) using Prime-it II Random Primer Labelling kit (Agilent, #300385) and oligonucleotides used as a probe were radiolabelled with [γ-32P]-ATP (Hartmann analytic #SRP-501) ...
-
bioRxiv - Pathology 2024Quote: RNA integrity and quantification was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 System (Agilent Technologies, CA, USA). RNA purity was checked using a NanoPhotometer spectrophotometer (IMPLEN ...
-
bioRxiv - Developmental Biology 2024Quote: ... Exome capture was performed using the IDT xGen Exome Research Panel v2.0 in conjunction with library preparation using the SureSelectXT kit (Agilent Technologies, California, USA) following the manufacturer’s recommendations and incorporating Illumina® 8-nt dual-indices ...
-
bioRxiv - Immunology 2023Quote: ... Mutations were introduced into cDNAs using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent, Santa Clara, CA, USA; cat. no. 200521) to construct expression vectors for S variants with a single amino acid change ...
-
bioRxiv - Physiology 2024Quote: ... Library quality assessment was performed twice during the library generation protocol with the Agilent Bioanalyzer High Sensitivity dsDNA kit (Agilent; 5067-4626). Completed libraries were quantified with both the Qubit high sensitivity dsDNA kit (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA library quality and quantity were determined using an Agilent 2100 bioanalyzer using the High Sensitivity DNA Reagents kit (Agilent, 5607-4626) and then sequenced on an Illumina NovaSeq 6000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA integrity and quantitation was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Molecular Biology 2024Quote: ... sgRNA-encoding genomic loci were amplified from up to 400 µg gDNA via PCR using a Herculase II Fusion Polymerase PCR kit (Agilent, Cat. #600677). Pooled reaction products from each treatment group were uniquely barcoded in a subsequent PCR reaction followed by electrophoresis on 2% TBE-agarose gel at 120 V ...
-
bioRxiv - Cancer Biology 2024Quote: ... The fragment size of the libraries was assessed using the Agilent Bioanalyzer 2100 with the High Sensitivity DNA kit (Agilent, 5067-4626). The concentration of the libraries was measured by the High Sensitivity QuBit kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... Final sequencing libraries were quantified using a Qbit DNA HS kit (Thermo #Q32856) for concentration and a Bioanalayzer HS DNA chip (Agilent #5067-4626) for amplicon size ...
-
bioRxiv - Molecular Biology 2024Quote: ... mRNA was checked pre and post poly(A)tail addition using an Agilent RNA 6000 Nano kit run on a 2100 BioAnalyser (Agilent Technologies, USA) (Fig ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA quality was determined by measuring the RNA integrity number (RIN) via the High Sensitive RNA Screen Tape Analysis kit (Agilent Technologies #5067) on the TapeStation system (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2024Quote: Quantification of glycolytic and mitochondrial ATP production was performed using the Seahorse XFe Real-Time ATP Rate Assay Kit (Agilent, #103591-100). Prior to cell adhesion ...
-
bioRxiv - Cell Biology 2024Quote: ... The integrity of RNA was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). After the fragmentation was carried out ...
-
bioRxiv - Molecular Biology 2024Quote: All mutants were generated by site-directed mutagenesis with the QuikChange XL II site-directed mutagenesis kit (Agilent, Santa Clara, CA, USA), as previously described (33).
-
bioRxiv - Cancer Biology 2024Quote: ... Drug was then washed out and 1x105 cells plated in 5 replicate wells for immediate analysis using the Mito Stress Test Kit (Agilent, 103015-100) according to the manufacturer’s instructions and using the following drug concentrations ...
-
bioRxiv - Cell Biology 2023Quote: Measurements of aerobic respiration and glycolysis were conducted with the Seahorse Bioscience XFe96 bioanalyzer using the seahorse XF Mito Stress Test Kit (Agilent #103015-100) and the Seahorse XF Real-Time ATP Rate Assay Kit (Agilent #103592-100) ...
-
bioRxiv - Cell Biology 2023Quote: ... GYF motif mutant GIGYF1 (GIGYF1 GYF Mut; G502A, Y503A, F504A) plasmids were created using the QuikChange II Site-Directed mutagenesis kit (Agilent Technologies, 200523). The chimeric constructs were synthesized by GenScript (Piscataway ...
-
bioRxiv - Immunology 2023Quote: ... Library quality and fragment size distribution were assessed by High Sensitivity DNA ScreenTape assay D1000 kit (Agilent Technologies, Santa Clara, CA, USA), and the concentration was determined using a Qubit fluorometer (LifeTechnologies ...
-
bioRxiv - Neuroscience 2023Quote: ... targeted mutagenesis was performed on the cloned WT p38γ by using the Quick-Change Lightning site-directed mutagenesis kit (Agilent Technologies; 210518) to create the kinase dead mutant.
-
bioRxiv - Neuroscience 2022Quote: ... RNA quantification and integrity were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). mRNA was purified using poly-T oligo-attached magnetic beads ...
-
bioRxiv - Genetics 2023Quote: Exome enrichment was applied to the cDNA purified from the previous step by using probe kit SSELXT Human All Exon V8 (Agilent, 5191-6879) for human samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total amounts and integrity of RNA were assessed using the RNANano 6000Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Three independent biological replicates were performed ...
-
bioRxiv - Cancer Biology 2023Quote: FISH assay was performed on tissue microarrays using the Histology FISH accessory kit (K579911-2, Dako, Agilent Technologies, Santa Clara, CA, USA) according to the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... USA) was used to check the purity (RNA Nano 6000 Assay Kit of the Bio-analyser 2100 system (Agilent Technologies, CA, USA) was used to detect the RNA integrity and assess quantitation.
-
bioRxiv - Molecular Biology 2023Quote: ... the A3 sequence specifying amino acids 21-393 was amplified from pHD1344tub(PAC)-Nterm3V5-A3 by error prone PCR using the GeneMorphII Random Mutagenesis kit (Agilent, Cat # 200523) and primers that add AttB sites (Table S2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Site-directed mutagenesis was performed on the pGAMA-YAP construct to create p-GAMA-YAP-S127A using the QuikChange Lightning kit (Agilent Technologies #210513). Forward primers used for the Ser-to-Ala substitution was as follows ...
-
bioRxiv - Physiology 2023Quote: ... RNA integrity number (RIN) was determined using an Agilent 2100 Bioanalyzer kit for total eukaryotic RNA (Agilent Technologies, Santa Clara, CA, USA). Samples underwent library preparation and sequencing at the UC Berkeley Functional Genomics and Vincent J ...
-
bioRxiv - Cancer Biology 2023Quote: ... The integrity of RNA was assessed by 1% agarose gel electrophoresis and integrity was validated by running the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, USA). A total of 1 μg RNA per sample was used as input material to generate the RNA-sequencing library using the Illumina NEBNext® UltraTM RNA Library Prep Kit following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quality control of the final libraries was completed on the Agilent 2100 Bioanalyzer using the High Sensitivity DNA Kit (Agilent, 5067-4626) to determine the average library sizes ...
-
bioRxiv - Cell Biology 2023Quote: ... Most missense and deletion mutations were inserted by site-directed mutagenesis using the QuikChange Lightning Kit (Agilent Technologies, Santa Clara, CA, USA) in combination with appropriate oligonucleotides (Supplements ...
-
bioRxiv - Neuroscience 2023Quote: ... The quality of the extracted RNA was assessed by the 2100 Bioanalyzer Instrument using Agilent RNA 6000 Pico kit (Agilent, CA, USA) and an average integrity quality number (RIN ...
-
bioRxiv - Genomics 2023Quote: ... Appropriate fragment size distributions were confirmed by running each sample on an Agilent Bioanalyzer using the DNA High-Sensitivity Kit (Agilent, #5067-4626).
-
bioRxiv - Immunology 2023Quote: ... and size distribution was assessed using the Agilent High Sensitivity DNA Kit on the Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA). Sequencing was performed using an Ion 540™ chip and the 540™ Chef kit on an Ion GeneStudio S5 sequencer.