Labshake search
Citations for Agilent :
751 - 773 of 773 citations for SARS Coronavirus Nucleoprotein N Term E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Molecular Biology 2023Quote: ... desorption was performed at 250°C for 1’ (splitless mode) in the injection port of a 6890 N gas chromatograph (Agilent Technologies) coupled to a 5975B mass spectrometer (Agilent Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Cell Biology 2023Quote: ... and the N-terminal 6xHis-tagged and C-terminal EGFP-tagged proteins were expressed in Arctic Express (DE3) RP cells (Agilent Technologies). Bacterial cultures in LB medium were induced with 0.1-0.2 mM IPTG at exponential growth phase (OD600 = 0.5-0.6 ...
-
bioRxiv - Biochemistry 2020Quote: ... Selenomethionine (SeMet)-labeled and native proteins were expressed in Escherichia coli BL21-CodonPlus (DE3)-RP-X and BL21-CodonPlus (DE3)-RIL (Agilent Technologies, Santa Clara, CA, USA), respectively ...
-
bioRxiv - Cell Biology 2020Quote: ... All mutations and the addition of the Myc-tag to the N-terminus of α-PheRS were made by following the procedure of the QuickChange® Site-Directed Mutagenesis Kit (Stratagene). The genomic α-PheRS rescue construct (Myc::α-PheRS ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides with PCa tissue samples (n=144) were incubated at 60°C for 2 hours followed by target retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Cell Biology 2020Quote: ... coli-optimized synthetic gene encoding the E2 ORF from HPV-16 (GenBank: AAD33255.1) was cloned into pCAL-N-FLAG (Agilent Technologies, CA, USA), which contains a vector-encoded N-terminal calmodulin bind site (CBS) ...
-
bioRxiv - Cell Biology 2021Quote: ... A P/O ratio of 2.75 has been validated for calculating the OXPHOS ATP production rate in cells (Romero N et al Quantifying Cellular ATP Production Rate Using Agilent Seahorse XF Technology). Thus ...
-
bioRxiv - Cell Biology 2022Quote: ... 120 μL of supernatant was removed from each tube and filtered using 0.2 μm polyvinylidene fluoride filter (Agilent Technologies P/N: 203980-100) and collected via 6,000 rcf centrifuge for 4 minutes ...
-
bioRxiv - Pathology 2022Quote: ... and a monoclonal antibody directed against the alpha isoform of smooth muscle actin at a working dilution of 1/100 (a-SMA, clone 1A4, n M0851; Dako, Denmark A/S). Alligator skeletal muscle was used as positive control for anti-desmin antibody (Supplemental figure 3A) ...
-
bioRxiv - Immunology 2023Quote: ... was amplified using primers listed in Table S2 and cloned into SrfI and EcoRI-linearized pCMVtag2B vector (N-terminal FLAG epitope-containing plasmid from Agilent Technologies, Cat# 211172) using Gibson Assembly (New England Biolabs ...
-
bioRxiv - Neuroscience 2024Quote: ... 10ug of total synaptosomal protein was plated in each well of a polyethyleneimine coated 96 well plate (n=5-6/animal) and analyzed using the MitoStress kit from Agilent (Santa Clara, CA). The MitoStress kit measures oxygen consumption rate (OCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... the plasmids containing the C- and N-terminally His-tagged human ACSS2 DNA were transformed into BL21 (DE3) RIL competent cells (Agilent Technologies, Wilmington, DE) and were expressed in auto-inducing media ZYP-5052 overnight at 15°C with shaking at 225 rpm ...
-
bioRxiv - Physiology 2022Quote: ... RNAs were extracted from n = 9 to 15 independent livers per group and RNA quality assessed using a TapeStation 4200 instrument (Agilent, Santa Clara, CA, USA). High quality RNA samples (RIN > 9.0 ...
-
bioRxiv - Plant Biology 2022Quote: Carotenoids and chlorophyll analysis was performed on one leaf per plant (n=10) using high-performance liquid chromatography (HPLC) (Agilent 1260 Infinity, Agilent, Santa Clara, CA, USA). Fully expanded mature leaves were punched from the middle position to collect leaf discs using a size 10 (2.54 cm2 leaf area ...
-
bioRxiv - Cancer Biology 2023Quote: ... that were freshly obtained prior to start of pembrolizumab (n=32) using the companion diagnostic assay of pembrolizumab (PD-L1 IHC 22C3 pharmDx, Agilent Technologies, Carpinteria, CA, USA). When no fresh tumor biopsy was available ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1:1000, ab183741, abcam; n-Myc: 1:500, 51705 Cell Signaling Technology; CD45: 1:1000, 70257 Cell Signaling Technology; CD3: 1:2000 A0452 Dako/Agilent) diluted in TBST+5% goat serum in a humid chamber overnight at 4°C ...
-
bioRxiv - Bioengineering 2020Quote: ... The concentration of the ester in the n-hexadecane phase was quantified using a gas chromatography-mass spectrometry (GC-MS, Agilent Technologies 6890N, Santa Clara, CA) equipped with an HP-5 column (60m×0.25 mm ...
-
bioRxiv - Physiology 2023Quote: ... Samples and standards were analysed in triplicate using an Agilent 5973 N mass selective detector coupled to an Agilent 6890 gas chromatography system (Agilent Technologies, Santa Clara, CA, USA). A CD624-GC column (30 m 30.25 mm 31.40 mm ...
-
bioRxiv - Molecular Biology 2023Quote: ... Desorption was performed at 250°C for 1’ (splitless mode) in the injection port of a 6890 N gas chromatograph (Agilent Technologies, Santa Clara, CA, USA) coupled to PEGASUS 4D mass spectrometer (LECO Corporation) ...
-
bioRxiv - Systems Biology 2024Quote: ... Samples and standards were analysed in triplicate by using an Agilent 5973 N mass selective detector coupled to an Agilent 6890 gas chromatography system (Agilent Technologies, Santa Clara, CA, USA). A CD624-GC column (30 m ...