Labshake search
Citations for Agilent :
751 - 800 of 2557 citations for 2 Amino 6 chloro 9 3 5 di O p toluoyl beta D 2 deoxyribofurnanosyl purine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: 2 × 105 BMDMs were plated into each well of Seahorse XF96 cell culture microplates (Agilent Technologies) and cultured overnight before treated with or without LPS plus ATP ...
-
bioRxiv - Cell Biology 2022Quote: ... Antibodies against EGFR (2-18C9) and Ki-67 (M1B1) were obtained from Agilent (Santa Clara, CA). The anti-MCT1 antibody was obtained from Merck (Rockville ...
-
bioRxiv - Genomics 2022Quote: ... Sections were incubated for 5min with hematoxylin (SigmaAldrich) followed by 2 min in bluing buffer (DAKO) and 10s in eosin Y (0.45M ...
-
bioRxiv - Microbiology 2022Quote: ... Growth measurements were obtained in a 96-well plate using an Epoch 2 Microplate Spectrophotometer (Agilent) inside of an anaerobic chamber ...
-
bioRxiv - Neuroscience 2022Quote: ... and were subsequently incubated with goat anti-rabbit labelled polymer EnVision+ Single Reagent (Dako, K400311-2) for 30 min at RT and peroxidase activity was revealed using DAB+ (Dako ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated 10 minutes in H2O2 solution (S202386-2, Agilent Technologies, Santa Clara, CA, USA) to quench endogenous peroxidases ...
-
bioRxiv - Cancer Biology 2024Quote: ... gaskets were removed and slides were mounted onto coverslips using Fluorescence Mounting Medium (S302380-2, Agilent). Images were acquired using a Zeiss Axio Scope.A1 fluorescence microscope with 40× and 100x magnifications and further analyzed with ImageJ ...
-
bioRxiv - Genomics 2023Quote: ... then air dried and mounted using an aqueous fluorescence mounting medium (Agilent Dako, Cat# S302380-2). Cells were visualized and imaged using an Olympus UPLXAPO 20×/0.8 NA air objective on a spinning disk confocal microscope (SpinSR10 ...
-
bioRxiv - Neuroscience 2023Quote: ... the labelled antibodies were developed with a Dako Liquid DAB+ substrate chromogen system (Dako; GV82511-2).
-
bioRxiv - Bioengineering 2023Quote: ... Slides were then mounted with Dako fluorescence mounting media (S302380-2, Agilent Technologies, Santa Clara, US). The primary antibodies and respective concentrations used in this study are the following ...
-
bioRxiv - Cell Biology 2023Quote: ... Optical density (OD) was measured with a BioTek Epoch 2 microplate spectrophotometer (Agilent, Santa Clara, CA) for at least 15 min to obtain blank values for each well at the target temperature ...
-
bioRxiv - Bioengineering 2022Quote: ... the sections were buffered in DAKO wash buffer (Cat #K800721-2, Agilent, Santa Clara, CA, USA) before incubating in primary antibody diluted in DAKO antibody diluent (Cat# S080983-2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and anti-CD45 clone 2B11 + PD7/26 (Ready-to-use, Agilent Dako cat. no. GA75161-2). After washing away the primary antibodies ...
-
bioRxiv - Cancer Biology 2022Quote: ... and anti-CD45 clone 2B11 + PD7/26 (Ready-to-use, Agilent Dako cat. no. GA75161-2). After washing away the primary antibodies ...
-
bioRxiv - Cancer Biology 2022Quote: ... The coverslips were then mounted on slides using DAKO Faramount Aqueous Mounting Medium (Agilent, #S302580-2). The slides were kept for 24h to allow the mounting media to cure before use.
-
bioRxiv - Cancer Biology 2023Quote: FISH assay was performed on tissue microarrays using the Histology FISH accessory kit (K579911-2, Dako, Agilent Technologies ...
-
bioRxiv - Bioengineering 2023Quote: ... we mounted the cultures on glass slides with DAKO anti-fading mounting medium (#S302380 − 2, Agilent) for confocal microscope imaging.
-
bioRxiv - Molecular Biology 2023Quote: ... or rabbit anti-goat IgG (500 ng ml−1, 1% BSA in PBST; Agilent, P044901-2), for 1 hour at room temperature ...
-
bioRxiv - Genomics 2023Quote: ... then air dried and mounted using an aqueous fluorescence mounting medium (Agilent Dako, Cat# S302380-2). Cells were visualized and imaged using an Olympus UPLXAPO 20×/0.8 NA air objective on a spinning disk confocal microscope (SpinSR10 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... slides were washed in blocking solution once more and treated with 3,3’-diaminobenzidine (DAKO K401011-2) for 5 minutes and counterstained with Gill 2 hematoxylin before brightfield imaging.
-
bioRxiv - Neuroscience 2024Quote: ... Fura-2 was excited at 340 and 380 nm with a Polychrome 3000 lamp (Agilent Technologies), and emitted light was captured by an EM-CCD camera iXON Ultra 897 (Andor ...
-
bioRxiv - Biochemistry 2024Quote: ... Bound Fc chimera was detected by incubation with anti-Human IgG HRP (Agilent Dako P021402-2) diluted 1:10000 in 1% BSA/PBS for 2 h ...
-
bioRxiv - Biochemistry 2024Quote: ... Bound Fc chimera was detected by incubation with anti-Human IgG HRP (Agilent Dako P021402-2) diluted 1:10000 in 1% BSA/PBS for 2 h ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and incubated at 30°C for 48 hours in a microplate reader (BioTek Epoch 2, Agilent). Optical density at 600 nm (OD600 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Molecular Biology 2022Quote: ... aliquots were alkylated with 50 mM PNBM (p-nitrobenzyl mesylate, Agilent) at a final concentration of 2.5 mM for 1 h at RT ...
-
bioRxiv - Neuroscience 2022Quote: ... Raw data (Agilent “.D” files) were analyzed using Agilent MassHunter software ...
-
bioRxiv - Plant Biology 2023Quote: ... raw “.D” files from Agilent were converted to “.CDF” format in Agilent Chemstation ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Neuroscience 2020Quote: RNA samples (50-100 ng) with RIN scores from 7.6 to 9 (Agilent 4200 TapeStation) were reverse transcribed to cDNA ...
-
bioRxiv - Neuroscience 2021Quote: ... The sections were treated with an antigen retrieval solution (Target Retrieval pH 9, #S2367, DAKO) for 20 min ...
-
bioRxiv - Immunology 2020Quote: ... Rehydrated sections were immersed in epitope retrieval buffer (Target Retrieval Solution, pH 9, DAKO Agilent), incubated at 97 °C for 40 min and cooled down to 65 °C using Lab vision PT module (Thermofisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... Rehydrated sections were immersed in epitope retrieval buffer (Target Retrieval Solution, pH 9, DAKO Agilent), incubated at 97 °C for 40 min and cooled down to 65 °C using Lab vision PT module (Thermofisher Scientific) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... an OD 260/280 ratio greater than 1.9 and a RIN > 9 (Agilent Bioanalyzer 2100) were chosen for cDNA library construction ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were lifted and seeded at 2×104 cells/well in XFe96 Cell Culture Microplate (Agilent Technologies) in 80 μl of fresh medium ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue sections were stained with 3,3’-diaminobenzidine solution (DAB; Liquid DAB+ Substrate Chromogen System, K346889-2, Dako), counterstained with hematoxylin ...
-
bioRxiv - Molecular Biology 2020Quote: ... membranes were incubated with rabbit anti-mouse horseradish peroxidase (HRP) conjugated antibody (P026002-2, Dako, 1:1000) as secondary antibody at RT for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... followed by EnVision FLEX DAB+ Chromogen in Substrate buffer (Agilent; anti-SARS-CoV-2, -CD8, -CD45R, -Iba1) for 10 min at RT or the DAB-Map-Kit (Ventana ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-CD3 antibody at a dilution of 1:200 (A045229-2, Dako Agilent Pathology Solutions), rat monoclonal anti-CD45 antibody at a dilution of 1:100 (05-1416 ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-CD3 antibody at a dilution of 1:200 (A045229-2, Dako Agilent Pathology Solutions), rat monoclonal anti-CD45 antibody at a dilution of 1:100 (05-1416 ...
-
bioRxiv - Microbiology 2020Quote: ... Optical densities were recorded at 600 nm every hour in Epoch 2 Microplate Reader (Biotek, Agilent Technologies).
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibodies and dilutions (dilution in DAKO REAL antibody diluent, S202230-2, DAKO, Carpinteria, CA, USA) used to study ALT were as follows ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides were rinsed in distilled water followed by treatment with EnVision FLEX Hematoxylin (Agilent DAKO, K800821-2). Slides were dried completely after rinsing in tap water and then dehydrated using xylene ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides were rinsed in distilled water followed by treatment with EnVision FLEX Hematoxylin (Agilent DAKO, K800821-2). Slides were dried completely after rinsing in tap water and then dehydrated using xylene ...
-
bioRxiv - Biophysics 2020Quote: Samples were thawed and injected onto a cooled (2 °C) HPLC System (Agilent Infinity 1260, Agilent Technologies) equipped with a home packed pepsin column (IDEX guard column with an internal volume of 60 µL ...