Labshake search
Citations for Agilent :
701 - 750 of 2557 citations for 2 Amino 6 chloro 9 3 5 di O p toluoyl beta D 2 deoxyribofurnanosyl purine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... HRP-conjugated polyclonal antibody (goat anti-rabbit) was purchased from DakoCytomation (Glostrup, Denmark; D048701-2). Mouse LH reference prep (AFP5306A ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... a drop of DAKO fluorescence mounting medium (Agilent Ref S302380-2, Santa Clara, CA, USA) was placed on a glass slide ...
-
bioRxiv - Microbiology 2024Quote: ... Sections for SARS-CoV-2 IHC were additionally blocked with 10% goat serum (X0907, DAKO) for 30 minutes at room temperature (RT) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2*105 CD8+T cells were seeded in a XFe96 microplates (cat#103793-100, Agilent). After treatment ...
-
bioRxiv - Cancer Biology 2024Quote: ... Antigen retrieval was done using 1x of Target Retrieval Solution pH9 (Agilent Dako, S236784-2) at 95-98°C for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... Antigen retrieval was done using 1x of Target Retrieval Solution pH9 (Agilent Dako, S236784-2) at 95-98°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... and GST or His6-MBP-tagged DI-DAX variants were transformed into BL21(DE3) Codon-Plus RIL Escherichia coli (Agilent, Santa Clara CA). A single colony or a scraping from a glycerol stock was used to inoculate a starter culture ...
-
bioRxiv - Neuroscience 2024Quote: ... 10ug of total synaptosomal protein was plated in each well of a polyethyleneimine coated 96 well plate (n=5-6/animal) and analyzed using the MitoStress kit from Agilent (Santa Clara, CA). The MitoStress kit measures oxygen consumption rate (OCR ...
-
bioRxiv - Cancer Biology 2022Quote: ... CK5/6 (IR 780, Dako), CK8 (35bH11 ...
-
bioRxiv - Cell Biology 2024Quote: ... Citrate pH 6 1X (Agilent) at 70°C for 40 minutes ...
-
bioRxiv - Genetics 2021Quote: ... Additional sequences were added to the 5’ (ACTGGCCGCTTGACG-) and 3’ (-CGCAGGAGCCGCAGTG) ends of each fragment and synthesized in a 100K pool by Agilent Technologies (Supplementary Table S2) ...
-
bioRxiv - Biochemistry 2020Quote: ... Selected mRNAs were purified and reverse-transcripted into single-chain DNA with the primer 5’-CTTCAGTTGCCGCTTTCTTTCTTG-3’ using a reverse transcriptase (Cat 200436, Agilent). The resulting cDNA library was purified using a DNA purification kit (Cat A740609.25 ...
-
bioRxiv - Cell Biology 2020Quote: ... were changed to 5′-ACCTGCAAAG −3′ by using the Quick-Change site directed mutagenesis Kit (Stratagene, La Jolla, CA, USA). Expression vectors for SENP2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent). The same kit was used to sequentially remove three nucleotides located at the 5’ end of the pCS2+-3’HA-sobp ORF to generate a construct whose transcribed mRNA does not bind to the designed translation-blocking antisense morpholino oligonucleotide (pCS2+-sobpMOI-3’HA ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
p97/VCP induces GLI1 to control XBP1-dependent endoplasmic reticulum stress transcriptional responsebioRxiv - Cancer Biology 2021Quote: ... The cells were washed 3 times with PBS for 5 min and then incubated with a secondary antibody: Flex-HRP (EnVision System, Dako) for 30 min and washed 3 times 5 min with PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Molecular Biology 2024Quote: Serial sections of human and mouse FFPE BM biopsies were prepared at 3-5 μm thickness on coated microscope slides (Dako FLEX, Agilent) and processed for immunohistochemistry/immunofluorescent-based (IHC-IF) ...
-
bioRxiv - Biochemistry 2024Quote: ... were kept in a 5°C autosampler prior to analysis and injected onto a reverse- phase Zorbax SB-C18 column (150×3 mm, 5 μm particle size, Agilent, Santa Clara ...
-
bioRxiv - Immunology 2020Quote: ... RNA integrity number (RIN) exceeded 9 for all samples measured by 2100 Bioanalyser (Agilent). RNASeq libraries where prepared using Smartseq2 as described by Picelli et al (64) ...
-
bioRxiv - Cancer Biology 2022Quote: ... tissues were rehydrated and cooked in DAKO Target Retrieval Solution pH 9 (#S236784, DAKO) for 20 min in microwave at ~600W ...
-
bioRxiv - Immunology 2023Quote: ... Heat induced epitope retrieval (HIER) was conducted using target retrieval solution pH 9 (Dako S236784-2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and an RNA integrity number ≥ 9 was assessed by TapeStation RNA Screen Tape (Agilent). RNA-seq analysis was performed with the transcriptome for targeted next-generation sequencing by Macrogen (Tokyo ...
-
bioRxiv - Immunology 2023Quote: ... or a monoclonal anti-C5b-9 antibody against the neoepitope (1:100, Agilent Dako) and incubated for 1h at RT ...
-
bioRxiv - Immunology 2023Quote: ... or a monoclonal anti-C5b-9 antibody against the neoepitope (1:100, Agilent Dako) and incubated for 1h at RT ...
-
bioRxiv - Microbiology 2021Quote: The determination conditions of bacillomycin D and fengycin were established by injecting 10 μL samples into an HPLC column (Eclipse XDB-C18, 5 μm; Agilent, Santa Clara, CA). The temperature was maintained at 30 °C during the experiment ...
-
bioRxiv - Immunology 2021Quote: Final V(D)J and 5’ GEX libraries were run on a Bioanalyzer 2100 with a High Sensitivity DNA kit (Agilent, Santa Clara, CA) to assess library size and concentration ...
-
bioRxiv - Plant Biology 2022Quote: ... whereas the amino acids were quantified using an HPLC system (Agilent 1100; Agilent) equipped with a Zorbax Eclipse Plus C18 column (4.6 mm × 150 mm ...
-
bioRxiv - Plant Biology 2022Quote: ... whereas the amino acids were quantified using an HPLC system (Agilent 1100; Agilent) equipped with a Zorbax Eclipse Plus C18 column (4.6 mm × 150 mm ...
-
bioRxiv - Microbiology 2020Quote: ... Amino acid analysis was performed by HPLC (Agilent 1100; Agilent Technologies, Massy, France) with a guard cartridge and a reverse phase C18 column (Zorbax Eclipse-AAA 3.5 μm ...
-
bioRxiv - Immunology 2021Quote: 2 × 105 BMDMs were plated into each well of Seahorse XF96 cell culture microplates (Agilent Technologies) and cultured overnight before treated with or without 20 ng/ml IL-4 for 6 or 24 h or ACs for 3 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of the ligation product was transformed into bacteria using XL10-Gold Ultracompetent Cells (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... then stained with: rabbit polyclonal (pAb) glial fibrillary acidic protein (GFAP,1:1000, Dako, Z033401-2), goat pAb glial fibrillary acidic protein (GFAP,1:300 ...
-
bioRxiv - Plant Biology 2020Quote: ... equipped with a 80/100 alumina column (1/8” x 2 mm x 1.5 m, Agilent) and set with the following parameters ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated for 2 hours in biotinylated swine anti-rabbit secondary antibody (1:200, Dako) followed by 2-hour incubation in Vectastain ABC (avidin-biotin ...
-
bioRxiv - Cancer Biology 2022Quote: ... Absorbance was measured at 564 nm with a Synergy 2 Multi-Detection Microplate Reader (Agilent Technologies) and normalized to a vehicle control ...
-
bioRxiv - Immunology 2020Quote: ... Thermo Fisher MA USA) followed by SA-HRP (1:2000 dilution, #P030701-2, Dako, CA USA), and visualised with TMB (#421101 ...
-
bioRxiv - Biochemistry 2022Quote: Anthocyanins were quantified using a UHPLC–DAD Agilent 1290 Infinity system (Agilent Technologies, USA; System 2). The UHPLC consisted of a diode-array (DAD ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and slides were incubated with Dako Serum Free Protein Block (#X090930-2, Agilent, Santa Clara, CA) for 30 minutes ...
-
bioRxiv - Immunology 2020Quote: ... The RBD domain of SARS-CoV-2 S was biotinylated and tetramerized with streptavidin-APC (Agilent). The APC decoy reagent was generated by conjugating SA-APC to Dylight 755 using a DyLight 755 antibody labeling kit (ThermoFisher) ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 µl of the solution was separated on a gas chromatograph (GC 7890A; Agilent Technologies) equipped with a Phenomenex ZB-35 (30m × 0.25mm × 0.25µm ...
-
bioRxiv - Neuroscience 2020Quote: ... transferred on glass slides and mounted for visualization with anti-fading mounting medium (Agilent #S302380-2). Confocal images were acquired using a Nikon Eclipse C1si laser-scanning microscope equipped with a 20x (NA 0.75 ...
-
bioRxiv - Biochemistry 2021Quote: ... in 2 mL headspace vials and analysed on an HPLC instrument (Agilent Technologies, 1260 Infinity II); peaks were identified using pure standards ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of the ligation product was transformed into bacteria using XL10-Gold Ultracompetent Cells (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... slides were blotted with the following primary antibodies: anti-insulin (IR00261-2, 1:4; Agilent Techologies) and anti-glucagon (g2654 ...
-
bioRxiv - Cell Biology 2021Quote: ... The pEGFP-C2-Myo15-2(jd) plasmid was generated using site directed mutagenesis (QuikChange II, Agilent) to introduce the jordan (c.4940A>G ...