Labshake search
Citations for Agilent :
7651 - 7700 of 9205 citations for Mouse Autophagy related protein 16 1 ATG16L1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines tested negative for mycoplasma using the Mycoplasma Plus™ PCR kit (#302008, Agilent Technologies, Santa Clara, CA, USA).
-
bioRxiv - Genomics 2022Quote: ... RNA integrity was assessed with the RNA nano 6000 assay kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA). In molluscs ...
-
bioRxiv - Genomics 2022Quote: ... The final size of ∼250 bp was assessed using a Fragment Analyzer genomic DNA analysis Kit (Agilent Technologies, Santa Clara, CA). For library preparation ...
-
bioRxiv - Immunology 2022Quote: ... the cDNA was evaluated for size distribution and quantity using the Fragment Analyzer High Sensitivity NGS Fragment Analysis Kit (Agilent Technologies) and the Qubit dsDNA HS Assay Kit (ThermoFisher ...
-
bioRxiv - Genetics 2022Quote: ... 2014) bearing FRQ point mutations to restriction-digested pCB05 in place of the QuickChange II® Site-directed Mutagenesis Kit (Stratagene). Four primer sets were used as flanks to facilitate homologous recombination in a yeast strain (FY834 ...
-
bioRxiv - Immunology 2022Quote: ... The resulting cDNA (equivalent to 500ng of total RNA) was amplified using the SYBR Green real-time PCR kit and detected on a Stratagene Mx3005 P (Agilent Technologies). qPCR was conducted using forward and reverse primers (sequences available upon request) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Deletion of putative TF binding sites from those enhancers were performed using QuickChange II XL site-directed mutagenesis kit (Agilent Technologies). All constructs were confirmed by Sanger Sequencing (Quintara Biosciences) ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were individually cleaned-up with 0.9 volumes of sample purification beads and concentration and size distributions were measured by Qubit™ dsDNA high sensitivity kit and by Agilent 2100 Bioanalyzer with the Agilent high sensitivity DNA kit ...
-
bioRxiv - Genomics 2022Quote: ... Amplified products were purified with the Zymo Research DNA Clean & Concentrator-5 kit and then analyzed for concentration and size distribution with a HSD5000 screentape (Agilent, #5067) on an Agilent 4150 TapeStation system ...
-
bioRxiv - Microbiology 2022Quote: ... hepaticus versus the tdTomato fluorescent protein (72 h transduction) was quantified in epithelial intestinal HT-29 cells using the Human GE 4x44K v2 Microarray Kit (Agilent Technologies) as we previously detailed [13 ...
-
bioRxiv - Pathology 2022Quote: Total RNA quantity and quality were assayed with an Agilent 2100 bioanalyzer instrument using the RNA 6000 Nano kit (Agilent Technologies). Libraries were prepared at Next Generation Sequencing Core at the University of Pennsylvania using TruSeq Stranded mRNA HT Sample Prep Kit (Illumina ...
-
bioRxiv - Plant Biology 2022Quote: ... The quality of the libraries was assessed using the Agilent 2100 High Sensitivity DNA Kit (Agilent Technologies, Santa Clara, CA, USA) and subjected to paired-end sequencing on the Illumina HiSeq 2500 platform (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... Yield of input and immunoprecipitate were independently quantified using a Bioanalyzer (Agilent RNA 6000 Pico Kit; Agilent Technologies, Santa Clara, USA) and Quant-IT RiboGreen Kit (ThermoFisher Scientific Inc. ...
-
bioRxiv - Molecular Biology 2023Quote: ... after which the RNA integrity number (RIN) was measured with Agilent 2100 Bioanalyzer using RNA 6000 Nano kit (Agilent, #5067-1511). All samples had RIN >9 ...
-
bioRxiv - Microbiology 2023Quote: ... BST2 M1A) and ATG5 (ATG5-K130R) were made by PCR mutagenesis using the QuikChange II XL site directed mutagenesis kit (Stratagene, France). The cDNA encoded ATG5-K130R was cloned in frame with GFP tag into the pEGFP-C1 vector ...
-
bioRxiv - Neuroscience 2022Quote: Small RNA and miRNA RNA quantity and quality in the nine EV samples were assessed by capillary electrophoresis in the 2100 Bioanalyzer and the Agilent Small RNA kit (Agilent Technologies). miRNA libraries were generated with the NEXTFLEX Small RNA Sequencing Kit v3 (©Bioo Scientific Corp. ...
-
bioRxiv - Microbiology 2023Quote: ... Point mutations were generated by site-directed mutagenesis according to the instruction manual of the QuikChange® mutagenesis kit (Agilent Technologies).
-
bioRxiv - Plant Biology 2023Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA). A total amount of 1.5 μg RNA per sample was used as input material for the RNA sample preparations ...
-
bioRxiv - Microbiology 2022Quote: ... The Agilent High Sensitivity DNA Kit for naturally contaminated shellfish was used to visualise second-round PCR products for Bioanalyzer 2100 (Agilent Technologies).
-
bioRxiv - Cancer Biology 2024Quote: ... and the library quality check has been performed using a High Sensitivity NGS Fragment Analysis Kit on a Fragment Analyzer System (Agilent Technologies). Indexed libraries were normalized and pooled to be sequenced on an Illumina Novaseq 6000 sequencer according to manufacturer’s instructions with targeted conditions of 2 x 75bp and 25M reads/sample.
-
bioRxiv - Neuroscience 2022Quote: ... was determined in primary astrocytes by measuring ECAR under basal conditions and in response to 0.5μM/0.5μM rotenone/antimycin A and 50 mM 2-deoxyglucose (2-DG) (all XFp Glycolytic Rate Assay Kit, Agilent Technologies, 103346-100) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... And RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). The library fragments (370 ~ 420 bp in length ...
-
bioRxiv - Plant Biology 2022Quote: ... The cDNA libraries were barcoded individually and analyzed for quantity and quality with the High Sensitivity DNA Analysis Kit in the Agilent 2100 Bioanalyzer (Agilent, USA). cDNA libraries were pooled in equal amounts for sequencing (single end ...
-
bioRxiv - Microbiology 2022Quote: ... were generated by site directed mutagenesis on HA-NOD2 plasmid (a gift from Dana Philpott) using the QuickChange II Site-Directed Mutagenesis kit (Agilent Technologies) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Residues 811-825 in the Mtb RNAP β flap were deleted using Quick Change II XL site-directed mutagenesis kit (Agilent). Variants of the wild type sigAP and sigAP”ext-10” (harboring the T-17G-16T-15G-14 motif ...
-
bioRxiv - Neuroscience 2022Quote: ... and L454A (or MA4-WRLAAA) were generated using appropriate primers and the QuikChange II XL Site-Directed Mutagenesis kit (Agilent Technologies) and were confirmed by DNA sequencing ...
-
bioRxiv - Neuroscience 2022Quote: ... the following primers were used to mutate the WIRS motif in the pcDNA3-DCCWT-HA construct using the Quikchange II site-directed mutagenesis kit (Agilent, #200523): CAACTCACCCACTCCGCGCCGCTGCTAATCCTTTGCTACC and GGTAGCAAAGGATTAGCAGCGGCGCGGAGTGGGTGAGTTG ...
-
bioRxiv - Neuroscience 2022Quote: ... and the p5xUAST-Fra-Myc constructs were subcloned into the smaller pBlueScript backbone and point mutations were introduced into the WIRS motif of the Fra coding sequences with the Quikchange II site-directed mutagenesis kit (Agilent, #200523) using the following primers ...
-
bioRxiv - Physiology 2022Quote: ... The real-time extracellular acidification rate (ECAR) was measured using the XFe96 extracellular flux analyzer with the Glycolysis Stress Kit (Agilent Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... and the size distribution was confirmed using a High Sensitivity DNA Kit for Bioanalyzer (Agilent Technologies, Cat. No. / ID: 5067-4626). Libraries were sequenced on an Illumina NextSeq2000 in paired end mode with the read length of 50 nt and sequencing depth of 20 million reads per library ...
-
bioRxiv - Microbiology 2022Quote: ... on a Qubit Fluorometer (invitrogen) and fragment length was assessed with an Agilent 2100 Bioanalyzer (Agilent High sensitivity DNA Kit, Agilent). Samples were equimolarly pooled and sequenced on NextSeq™ 500 High Output Kit v2.5 (75 cycles ...
-
bioRxiv - Cell Biology 2024Quote: Mutations in the DFCP1 (K193A and R266Q) and ATGL (D166G) were introduced using the QuikChange mutagenesis kit (Agilent, Santa Clara, CA).
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... RNA integrity was assessed using an RNA Nano 6000 Assay Kit on an Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Bioengineering 2024Quote: ... and extracellular acidification rate (ECAR) were measured following the manufacturer’s instructions for the Seahorse XF Cell Mito Stress Test Kit (Agilent, Madison, WI). Briefly ...
-
bioRxiv - Microbiology 2024Quote: ... The quality and quantity of each library was analyzed on the Bioanalyzer with a High Sensitivity DNA analysis Kit (Agilent technologies) and Collibri Library Quantification Kit (Invitrogen).
-
bioRxiv - Microbiology 2024Quote: ... The quality and quantity of each library was analyzed on the Bioanalyzer with a High Sensitivity DNA analysis Kit (Agilent technologies) and Collibri Library Quantification Kit (Invitrogen).
-
bioRxiv - Cancer Biology 2023Quote: ... The fragment was gel purified and used as template in error-prone PCR (EP-PCR) using the GeneMorph II kit and Mutazyme II polymerase (Agilent Technologies) and the primers (5RT 3RT) ...
-
bioRxiv - Biophysics 2024Quote: The recombinant human Cα subunit of cAMP-dependent protein kinase with the Phe to Ala mutation in position 100 (PKA-CF100A) was generated from the human PKA-Cα wild-type using Quik-Change Lightning mutagenesis kit (Agilent genomics). The key resource table lists the PCR primers used to modify the pET-28a expression vector encoding for the wild-type human PKA-Cα gene (PRKACA – uniprot P17612 ...
-
bioRxiv - Cell Biology 2024Quote: HEK293T cells were obtained from ATCC (CRL-3216) and verified to be free from mycoplasma contamination using the MycoSensor PCR Assay Kit (Agilent Technologies). Cells were cultured as in DMEM (Lonza ...
-
bioRxiv - Biophysics 2023Quote: ... or K280C (T) as well as the C242A mutation were introduced into the pETM30 vector using the QuikChange® mutagenesis kit (Stratagene) (17) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Post cDNA amplification and post-library construction quality control was performed using the Agilent Bioanalyzer High Sensitivity kit (Agilent 5067–4626). Libraries were sequenced using a NovaSeq 6000 and the S2 flow cell ...
-
bioRxiv - Molecular Biology 2024Quote: ... genomic DNA was fragmented into 180–280 bp by sonication and subjected to library preparation using the Agilent SureSelect Human All Exon V6 Kit (#5190-8864, Agilent Technologies). The enriched libraries underwent paired-end 150bp sequencing on the Illumina HiSeq 2000 platform.
-
bioRxiv - Molecular Biology 2024Quote: ... Mitochondrial probes used for visualization of mt-mRNA and mt-rRNA levels were restriction fragments labeled with α-32P-dCTP and a random priming kit (Agilent). Different mitochondrial tRNAs and 7S RNA were detected using specific oligonucleotides labeled with ψ-32P-ATP ...
-
bioRxiv - Physiology 2024Quote: ... Sample integrity was assessed prior to library preparation using the Bioanalyzer 2110 system with an RNA Nano 6000 Assay Kit (Agilent Technologies). One hundred fifty-base paired-end sequencing was performed using an Illumina NovaSeq platform according to manufacture instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... samples were analyzed on Fragment Analyzer with Genomic DNA 50kb Kit and TapeStation with either High Sensitivity D5000 ScreenTape System or High Sensitivity RNA ScreenTape System (Agilent Technologies) according to the manufacturer’s protocols [41-43] ...
-
bioRxiv - Genomics 2024Quote: ... The RNA quantity was assessed using the NanoDrop ND-1000 Spectrophotometer (Nanodrop Technologies) and the Agilent 2100 Bioanalyzer with the RNA 6000 Nano LabChip kit (Agilent Technologies). For DNA isolation ...
-
bioRxiv - Neuroscience 2024Quote: ... and assessed for RNA integrity using an RNA Kit on an Agilent 5300 Fragment Analyzer (Agilent Technologies, Palo Alto, CA, USA). The sequencing libraries were then multiplexed and loaded onto the Illumina NovaSeq 6000 instrument’s flowcell ...
-
bioRxiv - Neuroscience 2024Quote: ... The library molarity was determined by measuring the library size (approximately 330 bp) using the Fragment Analyzer 5300 and the Fragment Analyzer DNA HS NGS fragment kit (Agilent Technologies) and the library concentration (>2 ng/µl ...
-
bioRxiv - Immunology 2024Quote: ... we first inserted the SalI site at just downstream of the termination codon of the dsRed cDNA of pIRES2-dsRed-IRF418 using a QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies), and isolated the BglII-SalI fragment containing the mIRF4-IRES-dsRed DNA region from the mutated plasmid ...