Labshake search
Citations for Agilent :
701 - 750 of 1254 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... The RNA isolated for RT-qPCR was subjected to analysis using SurePrint G3 Mouse GE 8x60K Microarray (Agilent), according to the manufacturer’s instructions (Agilent SureScan) ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by quantification in technical triplicates with Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent) on the LightCycler 480 Instrument (Roche) ...
-
bioRxiv - Biophysics 2021Quote: ... with help of complementary primers containing mutations (Eurofins MWG Operon, Germany) using the QuikChange protocol for site-directed mutagenesis (Stratagene). Sanger sequencing either outsourced to SourceBioscience (Nottingham ...
-
bioRxiv - Biochemistry 2021Quote: ... The RNA was sheared and reverse transcribed with N6 random primers to obtain cDNA library and then qualified by Agilent 2100 Bioanalyzer ...
-
bioRxiv - Biochemistry 2022Quote: ... The H335A mutation that renders PLC-γ1 catalytically inactive was introduced into the transfer vector encoding wild-type PLC-γ1 (residues 21-1215) or PLC-γ1 (D1165H) using standard primer-mediated mutagenesis (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the CMV enhancer was amplified with the primers P322 and P323 using the phrGFPII-1 plasmid (Agilent Technologies, Santa Clara) as template ...
-
bioRxiv - Biochemistry 2020Quote: ... Selected mRNAs were purified and reverse-transcripted into single-chain DNA with the primer 5’-CTTCAGTTGCCGCTTTCTTTCTTG-3’ using a reverse transcriptase (Cat 200436, Agilent). The resulting cDNA library was purified using a DNA purification kit (Cat A740609.25 ...
-
bioRxiv - Immunology 2021Quote: ... Product was amplified and barcoded with adaptor specific primers and the quality of the resulting libraries were determined by Agilent Bioanalyzer ...
-
bioRxiv - Systems Biology 2022Quote: ... to remove larger DNA fragments and primer dimers and quality was assessed by Bioanalyzer (Agilent 2100, High Sensitivity DNA kit). Samples were pooled according to indexes for Illumina sequencing.
-
bioRxiv - Molecular Biology 2020Quote: ... were introduced using RE specific primers (Table 1 and Table 2 in supplementary material) by QuickChange Multi site-directed mutagenesis kit (Agilent) according to manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Transferred DNA was UV crosslinked to the membrane and hybridized with a 32P-labeled (Prime-It II Random Primer Labeling Kit, Agilent) Lpar1 probe with sequence external to the 5’ end of the targeting vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was reversed transcribed with MARS-seq barcoded RT primers in a 10 μl volume with the Affinity Script kit (Agilent). Reverse transcription was analyzed by qRT-PCR and samples with a similar CT were pooled (up to eight samples per pool) ...
-
bioRxiv - Neuroscience 2021Quote: ... Both Southern blot probes were generated by standard PCR and subjected to random labelling using a Prime-It II Random Primer Labelling Kit (#300385, Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... pCMVHA hEZH2 and V5-EZH2 vector was used to generate EZH2-H689A mutant vector using the mutagenesis primers listed in Table S1 with QuikChange II site-directed mutagenesis kit (Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Phosphorylation site mutations and gRNA sequences were introduced into vectors by PCR amplification with mutagenic primers (Table 3) with Phusion (Thermo) or PfuUltra II (Stratagene) polymerase ...
-
bioRxiv - Microbiology 2022Quote: ... a pool of sgRNA-encoding inserts was generated by PCR amplification with primers oJMP697 and oJMP698 from a 78-nt custom oligonucleotide library (2020-OL-J, Agilent) with the following conditions per 500 µl reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Microbiology 2024Quote: ... The E50A variant was further obtained by site-directed mutagenesis using an adapted protocol from the Stratagene “QuickChange” with only one mutator primer carrying the modified sequence and with both the Pfu turbo polymerase (Stratagene) and the Taq ligase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were then assessed for appropriate amplicon size and complete elimination of free primer peaks using the High Sensitivity ScreenTape Assay on the Tape Station2200 (Agilent) and quantified using the qPCR-based quantification in order to ensure only NGS-compatible amplicon was quantified using the Library Quant ROX Low Kit (Kapa Biosystems ...
-
bioRxiv - Molecular Biology 2024Quote: ... The quality and yield of fully-barcoded DNA primers was evaluated with total RNA Pico Assay (Agilent Technologies, 5067-1513) and by fluorescent in situ hybridization (FISH ...
-
bioRxiv - Genetics 2024Quote: Membranes were hybridized with “probe 4” for the HIS4::LEU2 hotspot 100 which was 32P-dCTP labelled using the Prime-It II Random Primer Labeling Kit (Stratagene). Following hybridization ...
-
bioRxiv - Microbiology 2023Quote: ... and a barcoding primer (unique for each sample to allow for demultiplexing of reads) with the Easy A cloning kit (Agilent). A 200–400 bp product was gel-purified and sequenced on an Illumina NextSeq Platform (in lab ...
-
bioRxiv - Microbiology 2023Quote: ... This DNA was then subject to an initial round of PCR amplification with primers oTB535 and oTB536 with the Easy A cloning kit (Agilent), digested with NotI (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... Point mutations in the repM gene were generated using specific primers and a QuikChange Site-Directed Mutagenesis kit according to the protocol supplied by the manufacturer (Stratagene). All oligonucleotide primers used in this study are listed in Supplementary Table S2.
-
bioRxiv - Developmental Biology 2023Quote: ... all libraries were ligated to NEBNext® Multiplex Oligos for Illumina® (Dual Index Primer Set I) and quality control was performed using a 2100 Bioanalyser High Sensitivity DNA Kit 5067-4626 (Agilent) and libraries quantified using a QubitTM Fluorometer following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... The purified capture products was then amplified using the SureSelect Post-Capture Indexing forward and Index PCR reverse primers (Agilent) for 12 cycles ...
-
bioRxiv - Neuroscience 2023Quote: ... pooled libraries were additionally purified with AMPure beads (ratio 1:1) to remove contaminating primer dimers and quantified using Qubit and the Bioanalyzer High-Sensitivity DNA kit (Agilent). 50-bp paired-end deep sequencing was carried out on HiSeq 4000 (Illumina).
-
bioRxiv - Plant Biology 2023Quote: CDS sequences from PhDEF and PhGLO1 were amplified from Petunia x hybrida R27 inflorescence cDNAs with primers MLY2382/MLY2383 and MLY2384/2385 respectively (Supplementary Table 1) and cloned into the in vitro translation vector pSPUTK (Stratagene) by NcoI/XbaI restriction ...
-
bioRxiv - Molecular Biology 2023Quote: ... The samples quantity and purity were determined using a NanoDrop spectrophotometer while the 4C PCR library efficiency and the absence of primer dimers were reconfirmed by Agilent Bioanalyzer ...
-
bioRxiv - Plant Biology 2023Quote: ... the first-strand complementary DNA (cDNA) was synthesized from 1 μg of RNA using oligo (dT) primers with Reverse Transcriptase (Agilent). Quantitative reverse transcription polymerase chain reaction (qRT-PCR ...
-
bioRxiv - Systems Biology 2023Quote: ... a pool of sgRNA-encoding inserts was generated by PCR amplification with primers oJMP697 and oJMP698 from a 78-nt custom oligonucleotide library (2020-OL-J, Agilent) with the following conditions per 500 µl reaction ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was amplified by PCR using the primers with Herculase II Fusion DNA polymerase (Agilent Technologies, Santa Clara, CA, USA). PCR products were separated by electrophoresis through a 2% agarose gel in 1× TBE and stained with GelRed (Biotium ...
-
bioRxiv - Microbiology 2023Quote: ... primer annealing and extension at 58°C for 30 s followed by dissociation step in a thermal cycler (Stratagene Mx3005P). Finally ...
-
bioRxiv - Biophysics 2023Quote: ... The His-TEV-mRaichu coding sequence was amplified by PCR using the primers GACGAATTCATGAATCACAAAGTGCATCAT and CTCGACAAGCTTTTAGATTCTGTGCTTTTAAGC and was inserted into the SmaI site of pBCKS (Stratagene). The coding sequence in the resultant plasmid was subcloned into the pFastBac™ Dual Expression Vector (Thermo Fisher ...
-
bioRxiv - Biochemistry 2023Quote: ... The NopD point mutants constructs were generated by different primers and were created by the QuickChange site-directed mutagenesis kit (Stratagene). All primers are shown in the Supplementary Table1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pB-T-PAF-Clu-TL1 was obtained by PCR-amplification of the entire plasmid with the mutagenic primers using Herculase-II (Agilent), followed by ligation with the KLD enzyme mix (NEB) ...
-
Development of a genetically encoded sensor for probing endogenous nociceptin opioid peptide releasebioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis and Circular Polymerase Extension Cloning was performed by polymerase chain reaction with custom designed primers using a Pfu-Ultra II fusion High Fidelity DNA Polymerase (Agilent). Sanger sequencing (Microsynth ...
-
bioRxiv - Microbiology 2024Quote: ... an alanine substitution was introduced into pH136A with specific mutagenic primer sets using the QuikChange site-directed mutagenesis protocol (Stratagene [Agilent] ...
-
bioRxiv - Biochemistry 2024Quote: ... The BTSL2 E98A and E664A variants were made by site-direct mutagenesis using the listed primers and QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent) according to the supplier’s manual.
-
bioRxiv - Biochemistry 2024Quote: ... Mutations T26V and K105C were introduced using custom-made DNA mutagenesis primers (Eurofins Genomics) and site-directed mutagenesis (PfuUltraII Fusion polymerase, Agilent), followed by sequencing the full coding frame (Eurofins Genomics or Macrogen) ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Microbiology 2020Quote: ... Reactions were set up in a 25 µl total volume with 12.5 µl Brilliant SYBR Green qPCR Master Mix (Agilent), 0.4 µM of each primer and 5 µl of prediluted DNA ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL template DNA and 10 μL Brilliant III Ultra-Fast QPCR Master Mix (Agilent Technologies, Santa Clara, CA). PCR was conducted with a Stratagene Mx3005P (Agilent technologies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Library quality control was performed with qPCR and a bioanalyzer (High Sensitivity DNA Analysis, Agilent, Santa Clara, CA, USA). Sequencing (three libraries of 96 multiplexed samples each ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions contained 10 µL of 2× Brilliant III Ultra-Fast SYBR green QPCR master mix (catalog no. 600882; Agilent), 2 µL each of 2 µM PCR primers (see Table S1 for used primers) ...
-
bioRxiv - Cell Biology 2023Quote: ... or directly processed by RT-qPCR using Brilliant III Ultra-Fast SYBR Green QRT-PCR Master Mix (Agilent Technologies), using primers designed with SnapGene® (version 6.1.1 ...
-
bioRxiv - Microbiology 2023Quote: ... Real-time Polymerase Chain Reaction (qPCR) was conducted in a Stragene Mx3005P real-time PCR system (Agilent Technologies®) to analyze the relative expression of the cytokine genes Interleukin 2 (IL-2) ...
-
bioRxiv - Plant Biology 2024Quote: ... and qRT–PCR experiments were performed with the “Brilliant III Ultra-Fast SYBR Green QPCR Master Mix” (Agilent Technologies) according to the manufacturer’s specifications ...
-
bioRxiv - Cell Biology 2024Quote: ... Amplification and quantification was performed using the Brilliant III Ultra-Fast qPCR Master Mix (Agilent, Santa Clara, CA, USA). Quantification was performed using the 2-ΔΔCt method ...
-
bioRxiv - Genetics 2024Quote: ... Reactions were set up in optical PCR tubes and run on an AriaMX Real-Time qPCR cycler (Agilent, USA) with Fam and Hex filters ...