Labshake search
Citations for Agilent :
7301 - 7350 of 9267 citations for Human Fragile X Mental Retardation 1 Neighbor Protein FMR1NB ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... labeled cRNA was prepared from 0.1 micro-g Total RNA using the Low Input Quick Amp Labeling Kit (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were prepared using the QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina (Lexogen) and assessed on a BioAnalyzer 2100 (Agilent) for library quantification and quality control ...
-
bioRxiv - Cancer Biology 2023Quote: ... An aliquot of this chromatin was used to assess the size of the DNA fragments obtained by High Sensitivity NGS Fragment Analysis Kit (DNF-474) on a Fragment AnalyzerTM (Agilent). ChIP was performed using IP-Star® Compact Automated System (Diagenode Cat# B03000002 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were washed twice with PBS-Tween and incubated for 30 minutes at room temperature with the Rabbit/Mouse EnVision kits (K4001/K4007, Dako). Slides were counterstained with hematoxylin and ...
-
bioRxiv - Physiology 2024Quote: ... Total RNA was amplified and Cy3-labeled by using the one-color Low Input Quick Amp Labeling Kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... Site-directed mutagenesis of this clone was conducted to generate a genomic clone of NRL5P335L using the QuikChange II site-directed mutagenesis kit (Agilent) following the manufacturer’s instructions ...
-
Mutations in HUA2 restore flowering in the Arabidopsis trehalose 6-phosphate synthase1 (tps1) mutantbioRxiv - Plant Biology 2024Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit on the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). RNA-seq libraries were generated with three independent biological replicates and sequenced on the Illumina NovaSeq platform by Annoroad Gene Technology ...
-
bioRxiv - Plant Biology 2024Quote: ... Fragmentation (at 60 °C) and hybridization (at 65° C for 16 hours) were done using the Gene Expression Hybridization kit of (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Final libraries were size-selected on Fragment Analyzer using the high-sensitivity Genomic Fragment Analyzer Kit (Agilent, Santa Clara, USA), quantified using the Fluoroskan plate fluorometer (Thermo Fisher Massachusetts ...
-
bioRxiv - Microbiology 2024Quote: To detect changes in neutralisation potency single point mutations were introduced into env encoding plasmids for PV production using the QuikChange Lightning Site-Directed Mutagenesis (SDM) kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were cleaned up using the Takara Nucleospin kit per manufacturers protocol and concentration and size range assessed using the D5000 Screentape (Agilent). 200fmol of each sample was barcoded and subject to library prep using the Native Barcoding Ligation Kit with V14 chemistry (SQK-NBD-114-24 ...
-
bioRxiv - Immunology 2023Quote: DNA whole exome libraries of B16-F10 cell line and C57BL/6JOlaHsd germline sample were prepared with Agilent Mouse All Exon kit (Agilent) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... On day 2 the XF Real-Time ATP Rate Assay Kit (Cat. No. 103592-100, Agilent Technologies, Cedar Creek, TX) was run following the manufacturer’s protocol using the Seahorse XF96 Analyzer as described above.
-
bioRxiv - Microbiology 2024Quote: ... TamA G271C and G574C substitutions were introduced into pXW48 using the QuikChange Site-Drected Mutagenesis Kit (Agilent catalog number 200524). Plasmids that encode bamABCDE8His-bamB (pYG120 ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA quantity and quality were determined using the Agilent RNA 6000 Pico Kit with Bioanalyzer 2100 system (Agilent Technologies, USA). Samples with high purity and RNA Integrity Number (RIN ...
-
bioRxiv - Plant Biology 2024Quote: ... and the quality of RNA based on the RNA Integrity Number was estimated using either the 2100 BioAnalyzer (Cat no: G2939BA; RNA 6000 Nano Kit; Cat no: 5067-1511. Agilent), 5200 Fragment Analyzer (Cat no ...
-
bioRxiv - Plant Biology 2024Quote: ... The quality of the adapter-ligated libraries was checked on the BioAnalyzer High Sensitivity DNA kit (Cat no: 5067-4626. Agilent) or Caliper GX LabChip GX/HT DNA high sensitivity kit (Cat no ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... from these samples (muscle or blood) using Qiagen MagAttract HMW DNA Kit and checked the DNA quality using TapeStation (Agilent), Qubit ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Final library quality was determined by Bioanalyzer 2100 using the Agilent High Sensitivity DNA Kit (Agilent, Cat. No. 5067-4626) and pooled together after normalizing samples based on their quantity from qPCR ...
-
bioRxiv - Immunology 2024Quote: Quantification of both the amplifications and libraries was performed using the Agilent Bioanalyzer High Sensitivity DNA assay (High-Sensitivity DNA Kit, Agilent) and KAPA Library Quantification Kit (Kapa biosynthesis) ...
-
bioRxiv - Developmental Biology 2024Quote: Site-directed mutagenesis of Branchiostoma floridae Pax6 cDNA cloned in pKW mammalian expression vector was performed by the Quick-Change kit (Stratagene) using primers zk2027A/zk2027B to generate Pax6ΔQL ...
-
bioRxiv - Developmental Biology 2024Quote: Donor plasmid PAM sites were mutated using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). The gRNA-encoding plasmids pU6-BbsI-chiRNA-RhoGEF2 and pU6-BbsI-chiRNA-Cysts were made by insertion of gRNA oligos into pU6-BbsI-chiRNA (Addgene #45946 ...
-
bioRxiv - Biochemistry 2024Quote: The expression vector encoding His-tagged SpNOXDH - aa 181-417 of full-length SpNOX - was obtained from SpNOX by site-directed mutagenesis according to the manufacturer’s protocol (QuikChange® Lightning Site-Directed Mutagenesis Kit, Agilent), using forward primer 5’GTCTGGTCCCGCGTGGCAGTAAAATTAGCTTTCCGTATCTGGG3’ and reverse primer 5’CCCAGATACGGAAAGCTAATTTTACTGCCACGCGGGACCAGAC3’ ...
-
bioRxiv - Microbiology 2024Quote: ... Library quality was assessed using High Sensitivity D1000 kit on a 4200 TapeStation instrument (Agilent Technologies, Santa Clara, CA, USA). The NovaSeq Sequencing System (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA quality was checked using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies, Santa Clara, CA, USA). DNA libraries suitable for sequencing were prepared from 10 ng of DNase-treated total RNA ...
-
bioRxiv - Microbiology 2024Quote: ... The integrity of the RNAs was verified using the Agilent 2100 bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies). RT-pPCR experiments and data analysis were performed as described (19) ...
-
bioRxiv - Genomics 2024Quote: ... cDNA libraries were quantified using the Qubit dsDNA Assay Kit (Thermo, Q32851) and library quality was assessed with the 4150 Tapestation System (Agilent) and D5000 screen tapes (Agilent ...
-
bioRxiv - Genetics 2024Quote: ... The BP-lowering rs1173771 haplotype was then constructed by site directed mutagenesis at the 11 SNPs locations in the haplotype using QuikChange II Site-directed mutagenesis kit (Agilent) and confirmed by Sanger sequencing ...
-
bioRxiv - Immunology 2024Quote: ... The glycolytic function of infected macrophage was analyzed by the Agilent Seahorse XF Glycolytic Stress Test Kit (Agilent, 103020-100). Mφs and amastigotes were distributed in Seahorse XF96 tissue culture microplates for 3 days at 34°C ...
-
bioRxiv - Biochemistry 2024Quote: ... were introduced into all TE expression plasmids in place of codons for the catalytic Ser or Cys residues using the QuikChange XL Site-Directed Mutagenesis kit (Agilent), optimized for GC-rich sequences (JuvEV TE S1637amb ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid for expression of the rare codon reporter pCIneo-RLuc (30xRC) was generated by site-directed mutagenesis using the QuikChange Site-Directed Mutagenesis kit (Stratagene). Protein mutant plasmids used in this study are listed in Supplementary Table S1 ...
-
bioRxiv - Genomics 2024Quote: ... RNA integrity (RIN) values for each sample were determined using the Agilent RNA 6000 Nano chip kit (Agilent, 5067-1511) and an Agilent Bioanalyzer 2100 instrument following the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2024Quote: ... and the mean fragment size was assessed using the DNA High Sensitivity KIT on a 2100 Bioanalyzer (Agilent Technologies, Netherlands). 4 nM pooled libraries was sequenced on NovaSeq S1 flow cell by Livestock Improvement Corporation Ltd ...
-
bioRxiv - Genomics 2024Quote: ... and quality checked using the Qubit dsDNA HS Assay Kit (Thermo cat. #Q32854) and a Bioanalyzer 2100 (Agilent cat. # G2939A) High Sensitivity DNA Kit (Agilent cat ...
-
bioRxiv - Immunology 2024Quote: ... From this construct, CDC42 point mutants (R186C, C188Y, Y64C) were obtained by site-directed mutagenesis (Quick change kit, Agilent Technologies). The *192C*24 plasmid was produced by ThermoFisher.
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting libraries tagged with unique dual indices were checked for size and quality using the Agilent High Sensitivity DNA Kit (Agilent). Library concentrations were measured using the KAPA SYBR Fast qPCR kit (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: ... The quality control and the fragment size distribution were determined using the DNF-474 High sensitivity NGS kit on a Fragment analyzer (Agilent).
-
bioRxiv - Cell Biology 2024Quote: ... were designed to replace the relevant amino acid residue with alanine and carried out using the PfuUltra II Fusion HS DNA Polymerase kit (600670, Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... SC/KD-miRNA-transduced MIN6 cells were cultured in 2 mM glucose and treated with a total RNA isolation mini kit (Agilent) and 1st strand synthesis kit (Origine) ...
-
bioRxiv - Plant Biology 2024Quote: ... Quality and quantity of the finished libraries were assessed using an Agilent DNA 1000 kit (Agilent Technologies, Santa Clara, CA) and Qubit® dsDNA HS Assay Kit (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: ... Site-directed mutagenesis was either provided by VectorBuilder or performed similar to the Quik-Change Site-Directed mutagenesis kit from Agilent Technologies (Santa Clara ...
-
bioRxiv - Biochemistry 2024Quote: ... The average size of the library was determined by the Agilent High Sensitivity DNA Kit (Agilent, Santa Clara, CA, USA). An accurate library quantification was determined using the Library Quantification Kit – Illumina/Universal Kit (KAPA Biosystems ...
-
bioRxiv - Neuroscience 2024Quote: ... The catalytic dead mutant PLCXD2- FLAG CD where histidine residues at position 57 and 132 were replaced with leucines was generated by in vitro mutagenesis using the QuikChange II Site-Directed Mutagenesis Kit (Agilent) from PLCXD2-FLAG ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). RNA-seq library construction was performed as described previously (Xu et al. ...
-
bioRxiv - Cell Biology 2024Quote: Measurements of oxygen consumption were conducted with the Seahorse Bioscience XFe96 bioanalyzer using the Seahorse XF Cell Mito Stress Test Kit (Cat# 103015-100, Agilent). hiPSC and progenitors were seeded on XF96 cell culture microplates (Cat# 102416-100 ...
-
bioRxiv - Cancer Biology 2024Quote: Mitochondrial oxygen consumption rates (OCR) were measured using the Agilent Seahorse XF Cell Mito Stress Test Kit and Seahorse XFe96 FluxPak (Agilent Technologies ...
-
bioRxiv - Microbiology 2024Quote: The site-directed mutants of PtPelA and PaPelA without its predicted signal sequence (amino acids 47-948 for PaPelA; accession Q9HZE4) were generated using the QuikChange Lightning site-directed mutagenesis kit (Stratagene). The sequence of all vectors was confirmed using DNA sequencing.
-
bioRxiv - Immunology 2024Quote: ... RNA was quantified by NanoDrop (Thermo-Fisher) and size distribution was analyzed by using Agilent RNA 6000 Nano kit (Agilent).
-
bioRxiv - Microbiology 2024Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA), and then sequenced on TruSeq PE Cluster Kit v3-cBot-HS (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... One hundred twenty-five ng of each sample was pooled prior to quality control and quantification on the 2100 Bioanalyzer system using DNA 7500 kit (Agilent) and KAPA Library Quantification Kit Illumina/Universal (Roche) ...