Labshake search
Citations for Agilent :
651 - 700 of 6621 citations for rno mir 101a Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... Quantification was made using gas chromatography with flame ionization detection (Agilent Technologies, 6890) fitted with a low polarity column (Rxi-5HT ...
-
bioRxiv - Bioengineering 2023Quote: ... and then transferred to a universal microplate reader for bioluminescence detection(Cytation1, Agilent). Based on the LDH method for evaluating killing efficiency ...
-
bioRxiv - Microbiology 2023Quote: ... For signal detection the samples were incubated with horseradish peroxidase-labelled streptavidin (Dako, Agilent Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... and a 30 min incubation at RT with Envision+System HRP Rabbit (Dako). The reaction was visualized with diaminobenzidin (DAB ...
-
bioRxiv - Microbiology 2019Quote: ... a 10 min incubation at room temperature (RT) with peroxidase blocking buffer (Dako) and a 30 min incubation at RT with Envision+System HRP Rabbit (Dako) ...
-
bioRxiv - Neuroscience 2021Quote: ... The RT reaction was performed using a thermal cycler (Agilent Technologies, Stratagene Mx3000P) with the following parameters ...
-
bioRxiv - Neuroscience 2021Quote: ... The RT reaction was performed using a thermal cycler (Agilent Technologies, Stratagene Mx3000P) with the following parameters ...
-
bioRxiv - Microbiology 2021Quote: ... and a 30 min incubation at RT with Envision+System HRP Rabbit (Agilent). The reaction was visualized with diaminobenzidin (DAB ...
-
bioRxiv - Microbiology 2023Quote: ... and a 30 min incubation at RT with Envision+System HRP Rabbit (Agilent). The reaction was visualized with diaminobenzidin (DAB ...
-
bioRxiv - Biochemistry 2023Quote: cDNA was used for RT-qPCR with miRNA QPCR Master Mix (Agilent Technologies). Universal reverse primers (Agilent Technologies ...
-
bioRxiv - Systems Biology 2022Quote: ... for migration time and then injected into a capillary electrophoresis time-of-flight mass spectrometry system (Agilent Technologies, Santa Clara, CA, USA) (27–29) ...
-
bioRxiv - Cancer Biology 2021Quote: ... rinsed three times in wash buffer (Dako, K800721-2), and blocked with 5% bovine serum albumin (BSA ...
-
bioRxiv - Biochemistry 2021Quote: ... coupled to time of flight mass spectrometry (6224 Agilent) (CE-TOF-MS ...
-
bioRxiv - Cell Biology 2021Quote: ... Hsc70D10N was generated by PCR-based site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). Cyclin D1 KO was conducted by CRISPR/Cas9 genome editing (Xie et al. ...
-
bioRxiv - Cell Biology 2020Quote: A library encoding ARHGAP36 isoform 2 mutants was created via error-prone PCR (epPCR) using the GeneMorph II Random Mutagenesis Kit (Agilent). To determine the optimal epPCR conditions for library generation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA probes were synthetized by cloning the DNA amplified region in the Strataclone PCR Cloning Kit (240205-5, Agilent Technologies) (hoxd12a ...
-
bioRxiv - Genomics 2020Quote: ... the amplified libraries were purified using a Qiagen MinElute PCR Purification Kit and eluted in 20 μl Elution Buffer before quantitation on an Agilent 4200 TapeStation (Agilent Technologies LDA UK Limited ...
-
bioRxiv - Developmental Biology 2019Quote: Pkin-29::kin-29SER517ALA was generated by modifying Pkin-29::kin-29cDNA using PCR-based mutagenesis (Quickchange II XL site-directed mutagenesis kit, Stratagene). The following primers were used ...
-
bioRxiv - Molecular Biology 2020Quote: ... the gene of FASTD71V,P73T was randomly mutagenized by error-prone PCR using the GeneMorph II Random Mutagenesis Kit (Agilent). The PCR product was digested with NheI and BamHI ...
-
bioRxiv - Cell Biology 2019Quote: ... Single-point mutants in PACRG were generated by PCR mutagenesis using the QuickChange II Site Directed Mutagenesis kit (Agilent Technologies). The pDB070.iodo.5 plasmid containing the modified tRNA and tRNA synthetase for p-iodo-L-phenylalanine incorporation was obtained from Addgene (#99397 ...
-
bioRxiv - Biochemistry 2020Quote: ... The error-prone PCR (epPCR) library of the gene encoding qmLC/A was created with the GeneMorph II kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: Mutations were generated in previously-described single-round plasmid derivatives of HIV-1NL4-3 (pNLdE-luc)48 and HIV-1LAI (pBru3ori-ΔEnv-luc2)49 that encoded for luciferase via the QuikChange site-directed PCR mutagenesis kit (Agilent). Resulting plasmid DNAs were verified by Sanger sequencing ...
-
bioRxiv - Biophysics 2022Quote: ... pcDNA3-Src K5R/K7R/K9R (Src 3R) mutants were obtained by PCR using the QuickChange Site-Directed Mutagenesis Kit (Stratagene); forward 5’:CCCTTCACCATGGGTAGCAACAGGAGCAGGCCCAGGGATGCCAGCCAGCGGCGCCGC ...
-
bioRxiv - Genomics 2022Quote: ... The library was amplified using 8 PCR cycles and verified on a Fragment Analyzer using the HS NGS fragment kit (Agilent). The library was quantified by qPCR using the KAPA Library quantification kit (Roche ...
-
bioRxiv - Plant Biology 2021Quote: ... Final libraries were amplified with 17 cycles of PCR and assessed on the Bioanalyzer with the High Sensitivity DNA kit (Agilent). All root tissue libraries that were sequenced comprised two biological replicates.
-
bioRxiv - Microbiology 2019Quote: ... We used pMotB.com plasmid as the PCR template for these substitutions using a site-directed mutagenesis kit (QuikChange, Stratagene Inc.) yielding plasmids MotB(D24E ...
-
bioRxiv - Cancer Biology 2019Quote: Both types of libraries ligation products were enriched with 15 PCR cycles and the final library was validated on an Agilent 2100 Bioanalyzer with the Agilent DNA 1000 Kit (Agilent).
-
bioRxiv - Genomics 2019Quote: ... a double-stranded DNA probe (obtained by PCR amplification using oligonucleotides AMO2002-2003) was 32P-labelled using the Prime-It II Random Primer Labeling Kit (Agilent), then hybridized overnight at 65°C in PerfectHyb™ Plus Hybridization Buffer (Sigma).
-
bioRxiv - Microbiology 2021Quote: All viral stocks were generated in Vero cells and tested negative for Mycoplasma contamination using a MycoSensor PCR Assay Kit (Agilent). Detailed passage histories of the ZIKV isolates used in this study were previously described (56) ...
-
bioRxiv - Cell Biology 2019Quote: ... Site-specific mutations of ACC2 and stop codon deletion constructs were performed using PCR-based mutagenesis (QuikChange II XL Site-Directed Mutagenesis Kit, Agilent). The plasmids for C-terminus GST-tagged or Flag-tagged ACC2 fragments were re-cloned from the human ACC2 plasmid using PCR and Gibson assembly ...
-
Engineering of a fluorescent chemogenetic reporter with tunable color for advanced live-cell imagingbioRxiv - Molecular Biology 2021Quote: The first yeast library (called library A in this study) of FAST constructed by error-prone PCR using Genemorph II kit (Agilent) was previously described23 ...
-
bioRxiv - Neuroscience 2021Quote: ... Both Southern blot probes were generated by standard PCR and subjected to random labelling using a Prime-It II Random Primer Labelling Kit (#300385, Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... 67)) plasmid as PCR template Bri2 BRICHOS D148N was obtained with QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, US), and the DNA sequence was confirmed (GATC Bioteq ...
-
bioRxiv - Biochemistry 2021Quote: ... Parkin mutant plasmids were cloned beginning with a Homo sapiens wild type eGFP-parkin vector [36] and performing PCR point mutagenesis (Quikchange Mutagenesis kit: Stratagene) utilizing primers ordered from Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... the PCR products from the genotyping of the first outcross (generation F1) were cloned into the cloning vectors provided by the StrataClone PCR cloning kit (Stratagene). The cloning was performed according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... 10X-barcoded full-length cDNA was then amplified via PCR and analyzed using Bioanalyzer High Sensitivity DNA kit (5067-4626, Agilent). Up to 50 ng of cDNA was carried over to construct gene expression libraries and was enzymatically fragmented and size-selected to optimize the cDNA amplicon size prior to 5’ gene expression library construction ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... the ChT swapping mutants using fusion PCR and the point mutations using site-directed mutagenesis by a QuikChangeII kit (Agilent) with the primers listed in supplemental information (Table S1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... All K-Ras secondary mutant and wild-type K-Ras constructs were generated by a PCR based strategy using a site-directed mutagenesis kit (Stratagene) according to the manufacturer’s instructions ...
-
Species-specific protein-protein interactions govern the humanization of the 20S proteasome in yeastbioRxiv - Genetics 2022Quote: The PSMB7 mutant gene library was previously generated (Kachroo et al, 2015) by error-prone PCR (GeneMorph II Random Mutagenesis Kit from Agilent) to introduce mutations and add attL1 and attL2 sites at the 5’ and 3’ ends of the gene (Reece-Hoyes & Walhout ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 ng of extracted PCR products were analyzed by an Agilent High Sensitivity DNA kit on an Agilent 2100 Bioanalyzer (Agilent), and the remainder was cloned by using PCR Cloning Kit (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: ... Amplified DNA from F1 mutants was used for cloning with the StrataClone PCR Cloning Kit (Agilent; Santa Clara, CA, USA) and then transformed with StrataClone SoloPack (Agilent ...
-
bioRxiv - Microbiology 2023Quote: ... This DNA was then subject to an initial round of PCR amplification with primers oTB535 and oTB536 with the Easy A cloning kit (Agilent), digested with NotI (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... The tau P301L mutants were generated by PCR using QuickChange Lightning Site-Direct mutagenesis kit (Agilent Technologies, Santa Clara, USA). For all intermolecular sensors ...
-
bioRxiv - Cell Biology 2023Quote: ... the pK2:Nβ-GFP construct was used as template for site-directed mutagenesis by PCR using the QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) following the manufacturer’s instructions with the concomitant mutagenic primers for each target base substitution (S2 Table) ...
-
bioRxiv - Biochemistry 2022Quote: ... The N165A and N234A variants of HDM-SARS2-S-del21-D614G were generated by site-directed PCR mutagenesis using the QuickChange II kit (Agilent), and changes were confirmed by sequencing ...
-
bioRxiv - Cell Biology 2023Quote: All TTBK2 mutations were generated by PCR-based site-directed mutagenesis by using QuickChange Lighting Site-Directed-Mutagenesis kit (Agilent) using as a template pENTR/D-TOPO (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... The library of CjCas9 variants was produced by random mutagenesis of the wild-type sequence using error-prone PCR approach (GeneMorph II kit from Agilent) (for primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10X-barcoded full-length cDNA was then amplified by PCR and analysed using Bioanalyzer High Sensitivity DNA kit (5067-4626, Agilent). Up to 50 ng of cDNA was carried over to construct gene expression libraries and was enzymatically fragmented and size-selected to optimize the cDNA amplicon size prior to 5’ gene expression library construction ...
-
bioRxiv - Molecular Biology 2023Quote: ... Site directed mutagenesis of pORIPS and pGII was performed by PCR using the QuikChange II Site-directed mutagenesis kit (Agilent).
-
bioRxiv - Cancer Biology 2021Quote: ... Endogenous peroxidase activity was blocked by incubation with REAL Peroxidase-Blocking Solution (Dako) at room temperature for 10 min ...