Labshake search
Citations for Agilent :
501 - 550 of 6621 citations for rno mir 101a Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and then with streptavidin-HRP complex followed by 3,3-diaminobenzidine or 3-amino-9-ethylcarbazole detection (LSAB kit, Dako France). Sections were then counterstained with hematoxylin ...
-
bioRxiv - Neuroscience 2021Quote: ... Detection was carried out with the LSAB2 System-HRP (anti-rabbit/mouse LSAB2 Kit Dako Cat#K0679, dilution 1:100) or the VECTASTAIN Elite ABC HRP Kit (Vector Labs ...
-
bioRxiv - Genetics 2019Quote: ... Isolated RNA was reverse transcribed into cDNA was by Prime Script TM RT reagent Kit with gDNA Eraser (Stratagene, Takara). Real-time PCR was performed on ABI-7500 real-time PCR machine (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was reversed transcribed with MARS-seq barcoded RT primers in a 10 μl volume with the Affinity Script kit (Agilent). Reverse transcription was analyzed by qRT-PCR and samples with a similar CT were pooled (up to eight samples per pool) ...
-
bioRxiv - Biochemistry 2021Quote: ... AccuScript high-fidelity first-strand cDNA synthesis kit for reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) was procured from Agilent.
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Cell Biology 2021Quote: ... QuantiTect primer assays and Brilliant III SYBR Green QRT-PCR Kit (Agilent Technologies) in a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplicons were cloned using Strata Clone PCR Cloning Kit (Agilent, Santa Clara, USA). The 18S rRNA gene sequences from the isolates have been deposited in GenBank under the accession numbers XXXXXXX.
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were tested negative for mycoplasma using the Mycosensor PCR assay kit (Agilent) or the LookOut Mycoplasma PCR detection kit (Sigma-Aldrich).
-
bioRxiv - Genetics 2021Quote: ... Random mutagenesis PCR was carried out with GeneMorph II Random Mutagenesis Kit (Agilent) following the manufacturer’s instructions with the following specifics ...
-
bioRxiv - Biochemistry 2021Quote: ... error-prone PCR was performed using the GeneMorph II Random Mutagenesis Kit (Agilent). Hereby ...
-
bioRxiv - Biochemistry 2023Quote: ... Amplified DNA was subcloned with StrataClone Blunt PCR cloning kit (Agilent Technologies, 240207) and sequenced with M13 Forward ...
-
bioRxiv - Genetics 2023Quote: ... and Illumina adapters were added (second PCR) in a nested PCR manner using Agilent Herculase II Fusion DNA Polymerase Kit (Agilent, Cat # 600679). The PCR products were purified and sequenced using an Illumina NextSeq ...
-
bioRxiv - Molecular Biology 2024Quote: ... sgRNA-encoding genomic loci were amplified from up to 400 µg gDNA via PCR using a Herculase II Fusion Polymerase PCR kit (Agilent, Cat. #600677). Pooled reaction products from each treatment group were uniquely barcoded in a subsequent PCR reaction followed by electrophoresis on 2% TBE-agarose gel at 120 V ...
-
bioRxiv - Cancer Biology 2022Quote: ... For signal detection the MACH 3 Mouse HRP Polymer Detection system was employed according to manufacturer’s protocol using DAB+ (Fa.Agilent Technologies, K3468). Slides were counter-stained with Hematoxylin Gill’s Formula (Fa.Vector ...
-
bioRxiv - Pathology 2020Quote: ... Sections were allowed to thaw at RT and thereafter blocked for > 60 min at RT with blocking-buffer (serum-free protein blocking solution, DAKO), supplemented with 0.2% Triton X-100 (Sigma Aldrich) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Detection was performed using the EnVision method (Dako) and counterstaining was done with hemalum solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... coupled to camera-based detection (AI600, Agilent technologies) was used to visualize protein bands.
-
bioRxiv - Cell Biology 2023Quote: ... Probes (available in Table S7) were labeled with 32P-dCTP using the Prime-It RT random labeling kit (Agilent, catalog #300329) and hybridized to the membrane ...
-
bioRxiv - Immunology 2023Quote: ... RT-qPCR was performed with a StepOnePlus (Agilent) using the Luna Universal qPCR Master Mix (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: RT-qPCR was performed with a StepOnePlus (Agilent) using the Luna Universal qPCR Master Mix (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μL of SST1-F/R PCR product was cloned into pSC-A-amp/kan vector using Strataclone™ PCR Cloning Kit (Agilent, Cat.#240205) following manufacturer’s instructions and transformed into E ...
-
bioRxiv - Biochemistry 2022Quote: ... The preparation of variants was achieved through an error-prone PCR mutagenesis kit (GeneMorph II Random Mutagenesis Kit – Agilent Technologies), following the manufacturer’s instructions in order to insure high proportion of single-mutant variants ...
-
bioRxiv - Biochemistry 2021Quote: ... Cell lines were periodically tested for mycoplasma using the MycoSensor PCR Assay Kit (Agilent).
-
bioRxiv - Microbiology 2021Quote: ... the Brilliant III Ultra-Fast SYBR® Green one-step qRT-PCR kit (Agilent) was used ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were tested regularly for mycoplasma by using a PCR-based kit from Agilent Technologies ...
-
bioRxiv - Genomics 2019Quote: ... The obtained cDNA fragments were cloned using the Strataclone PCR cloning Kit (Agilent Technologies), and the positive clones were sequenced on an ABI 310 Automated Sequencer (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2022Quote: ... Amplified cDNA was cloned into pSC plasmid (StrataClone Blunt PCR Cloning Kit, STRATAGENE, 240207). Then ...
-
bioRxiv - Microbiology 2022Quote: ... The Brilliant III Ultra-Fast SYBR® Green one-step qRT-PCR kit (Agilent) was used for all qRT-PCR reactions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Error-prone PCR was performed using the GeneMorph II EZClone Domain Mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Dako REAL Peroxidase-blocking reagent (Agilent S202386-2), bluing reagent (Leica ...
-
bioRxiv - Cancer Biology 2021Quote: ... qRT-PCR was performed as previously described (Sodi et al., 2015) using Brilliant II qRT-PCR Master Mix 2 Kit (Stratagene, San Diego, CA, USA) using Applied Biosystems 7500 machine. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Detection was conducted using the DAB Chromogen System (Dako).
-
bioRxiv - Immunology 2022Quote: ... was used as the detection system with AEC (Agilent) as a chromogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... using the envision HRP Detection system (Dako, Carpinteria, CA). Sections were deparaffinized in xylene ...
-
bioRxiv - Cell Biology 2023Quote: ... on the MX3000p qPCR detection system (Stratagene, Agilent Technologies). Primers (Supplementary Table II ...
-
bioRxiv - Cell Biology 2023Quote: ... on the MX3000p qPCR detection system (Stratagene, Agilent Technologies). Primers (Supplementary Table II ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were reversed transcribed using AffinityScript RT Enzyme (Agilent) to form cDNA ...
-
bioRxiv - Microbiology 2023Quote: ... The RT-qPCR was run on a Mx3000P (Agilent) using an annealing temperature of 60°C and analyzed against a standard curve of Mitochondrial 18S ribosomal RNA (RRN18S ...
-
bioRxiv - Neuroscience 2020Quote: ... the staining was revealed by 30 min incubation in a HRP-anti rabbit polymer system (DAKO REAL Envision™ Kit, #K400311-2, Agilent, France) followed by a DAB revelation of few seconds (DAKO DAB Kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... The other plasmids were obtained by PCR using the QuickChange Site-Directed Mutagenesis Kit (Stratagene) using specific oligonucleotides as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... The libraries were amplified with 7 PCR cycles using Herculase II Fusion Polymerase kit (Agilent). Libraries were next hybridized in the following way ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was performed using SYBR Green One-Step (Kit# 600825, Agilent, Santa Clara, CA). qRT-PCR data were analyzed using the Sequence Detection System software (SDS Version 2.2 ...
-
bioRxiv - Molecular Biology 2022Quote: In-vitro mutagenesis by PCR-mediated recombination QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) was performed using the cDNA of human GPRC6A cloned in the vector pcDNA3 (Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... and cloned into a plasmid vector using the StrataClone blunt PCR cloning kit (Agilent; 240207). Colonies were selected and grown in 4ml 2xTY media supplemented with Ampicillin (10μg/ml) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell lines were tested for Mycoplasma contamination using MycoSensor PCR Assay Kit (Agilent, Didcot, UK).
-
bioRxiv - Cell Biology 2020Quote: ... TC10 mutants were produced through PCR-based site-directed mutagenesis using the Quikchange kit (Stratagene). For the Q75L mutation ...
-
bioRxiv - Neuroscience 2020Quote: ... SEP-GluA1-S845A was generated by PCR based QuikChange® Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and cloned into pSC-A-amp/kn using a StrataClone PCR Cloning Kit (Agilent Technologies). Plasmids were then Sanger sequenced using T7/T3 primers or the original PCR primers (MWG Eurofins) ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR-based mutagenesis kit exactly as described by the manufacturer (Stratagene, La Jolla, CA, USA). Mutagenized clones were isolated and subjected to Sanger DNA sequencing to verify the entire coding sequence for the presence of the desired mutation and the absence of any PCR-induced sequence errors.