Labshake search
Citations for Agilent :
6601 - 6650 of 6919 citations for Nitrite Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... The labeling and hybridization steps were conducted in accordance with the provided instructions using the SureTag DNA Labelling kit (Agilent Technologies, USA). Equal amounts of DNA labeled with fluorescent markers were combined and co-hybridized onto a 44LK DNA microarray ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The RNA quality was evaluated using the 5200 Fragment Analyzer System and the Agilent HS RNA Kit (Agilent Technologies, Inc., CA, USA). After the ribosomal RNA depletion with the RiboPOOL kit (siTOOLs Biotech GmbH ...
-
bioRxiv - Neuroscience 2023Quote: ... were used for each replicate and placed into 100 µL of lysis buffer + β-mercaptoethanol from the Absolutely RNA Microprep kit (Agilent Technologies). Each genotype was prepared in quadruplicate ...
-
bioRxiv - Immunology 2023Quote: ... Mutations were introduced into cDNAs using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent, Santa Clara, CA, USA; cat. no. 200521) to construct expression vectors for S variants with a single amino acid change ...
-
bioRxiv - Cell Biology 2023Quote: ... GYF motif mutant GIGYF1 (GIGYF1 GYF Mut; G502A, Y503A, F504A) plasmids were created using the QuikChange II Site-Directed mutagenesis kit (Agilent Technologies, 200523). The chimeric constructs were synthesized by GenScript (Piscataway ...
-
bioRxiv - Physiology 2024Quote: ... for assessment of the RNA integrity by the RNA 6000 Nano Chip Kit with the Agilent 2100 Bioanalyzer (Agilent Technologies, Waldbronn, Germany), and samples with RIN number above 7.5 were used for micro-array analysis ...
-
bioRxiv - Microbiology 2023Quote: ... and their concentrations were checked by Qubit (ThermoFischer Scientific) followed by quality assessment through Agilent 2100 BioAnalyzer (Agilent RNA 6000 Nano Kit). Both sets of RNA seq represented in Figures 1 and 5 were processed and run at the same time ...
-
bioRxiv - Plant Biology 2024Quote: ... The quality of RNA was assessed using an Agilent RNA 6000 Nano Kit on the Bioanalyzer 2100 (Agilent Technologies, Santa Clara, USA). Only samples with an RNA integrity number (RIN ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA and library quality control were performed using an Agilent 2100 Bioanalyzer using the Bioanalyzer High Sensitivity DNA kit (Agilent #5067-4626). Sequencing was performed by Azenta Biosciences using a NovaSeq instrument.
-
bioRxiv - Genomics 2024Quote: ... #Q32854) was used to assess RNA concentration and RIN values were determined using the Bioanalyzer Pico RNA kit (Agilent cat. #5067-1513), with average RIN scores of 8.2 for the adrenal gland ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA library quality and quantity were determined using an Agilent 2100 bioanalyzer using the High Sensitivity DNA Reagents kit (Agilent, 5607-4626) and then sequenced on an Illumina NovaSeq 6000 ...
-
bioRxiv - Immunology 2024Quote: ... The mitochondrial function of macrophages and amastigotes was analyzed by the Agilent Seahorse XF Cell Mito Stress Test Kit (Agilent, 103015-100). The glycolytic function of infected macrophage was analyzed by the Agilent Seahorse XF Glycolytic Stress Test Kit (Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral vector carrying mutant SPDEF (G277D) was generated using QuikChange II XL Site-Directed Mutagenesis Kit (cat# 200521, Agilent, Santa Clara, CA) with oligonucleotides (5’-tcctcaattttgaagatgtccttctccttgttgagcc-3’ and 5’-ggctcaacaaggagaaggacatcttcaaaattgagga-3’ obtained from IDT ...
-
bioRxiv - Developmental Biology 2024Quote: Individual and combination mutant versions of Homo sapiens CTNNB1 DNA constructs were generated using standard cloning techniques and the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, 200521), unless otherwise noted ...
-
bioRxiv - Plant Biology 2024Quote: ... Quality and quantity of the finished libraries were assessed using an Agilent 4200 TapeStation DNA 1000 kit (Agilent Technologies, Santa Clara, CA) and Qubit® dsDNA HS Assay Kit (ThermoFisher Scientific) ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR probes were labelled with [α-32P]-dCTP (Hartmann Analytic #SRP-305) using the Prime-it II Random Primer Labelling Kit (Agilent, #EK0031) and purified on illustra Microspin G-50 columns (Cytiva #27533001 ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was extracted from the beads and purified according to the manufacturer’s instructions using an Absolutely RNA nanoprep kit (Stratagene, La Jolla, CA) with in column DNA digestion and frozen prior to gene expression profiling being performed ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and the library profile was assessed using a High Sensitivity DNA kit on an Agilent Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). The library was then sequenced to approximately 50x coverage on an Illumina HiSeq 4000 instrument (Illumina ...
-
bioRxiv - Biochemistry 2024Quote: ... Introduction of mutation (ATG to TAA) into the pcDNA3.1-HA-mGluR2-mCitrine construct was performed with the QuikChange II Site-Directed Mutagenesis Kit (Agilent, Catalog no. 200523) (for primer pairs ...
-
bioRxiv - Molecular Biology 2024Quote: ... 150 ng of purified RNA was mixed with RNA standards (One Colour RNA Spike-In Kit; Agilent, Santa Clara, CA – 5188–5282) and the mixture labelled with LowInput QuickAmp Labeling Kit One-Color (Agilent 5190-2305) ...
-
bioRxiv - Physiology 2024Quote: ... Library quality controls were performed by using Agilent High Sensitive DNA kit with Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA) and quantified by Qubit 2.0 fluorometer (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μL of SST1-F/R PCR product was cloned into pSC-A-amp/kan vector using Strataclone™ PCR Cloning Kit (Agilent, Cat.#240205) following manufacturer’s instructions and transformed into E ...
-
bioRxiv - Cell Biology 2020Quote: Rapsyn-FLAG and rapsyn-Venus1 E162K mutants were generated by site-directed mutagenesis using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... pEGFP-C1-tubbyCT R332H and pEGFP-C1-tubbyCT Y343F were generated using QuikChange II XL Site-Directed mutagenesis kit (Stratagene, Agilent Technologies, Waldbronn, Germany). pEGFP-C1-tubbyCT KR330/332AA was generated by mutagenesis PCR using PfuUltra II Hotstart PCR Master Mix (Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... The quality and quantity of extracted RNA were measured by on-chip electrophoresis utilizing the Agilent RNA 6000 Nano Kit and Agilent 2100 Bioanalyzer (Agilent Technologies, CA, USA). Samples exhibited 1.9≤A260/A280◻≤◻2.2 ...
-
bioRxiv - Microbiology 2019Quote: ... Complementation of ΔfimB mutants were performed by cloning the promoter and encoding regions of the parental fimB genes into pSC-A-amp/kan (Table S4) by using the StrataClone PCR Cloning Kit (Agilent Technologies, Massy, France). The recombinant plasmid was then electroporated into competent strains S250ΔfimB: ...
-
bioRxiv - Neuroscience 2021Quote: ... Biotin-labeled amplified RNA (aRNA) size distribution and quantity was analyzed with the Agilent 2100 Bioanalyser using the RNA 6000 Nano LabChip kit (Agilent Technologies, Boeblingen, Germany). Samples with lower size compressed RNA products were discarded ...
-
bioRxiv - Molecular Biology 2020Quote: ... All site-directed mutagenesis reactions were performed by following the instructions in the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene, CA). Primers used for PCR and site-directed mutagenesis reactions are indicated in Supplemental Table S2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The integrity of the synthesized RNAs was assessed using Agilent RNA 6000 Nano Kit with Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA), these newly synthesized sgRNA constructs will be referred to as RP Loop sgRNA (RP-loop sgRNA ...
-
Single-cell analysis of skeletal muscle macrophages reveals age-associated functional subpopulationsbioRxiv - Cell Biology 2022Quote: ... cDNAs were then used for library preparation and the quality of the final libraries assessed on the Agilent Bioanalyzer with DNA 1000 kit (Agilent, Cat# 5067-1504). The libraries were sequenced with Illumina Nova-sequencer with a depth of 300-400 million reads per sample ...
-
bioRxiv - Genomics 2020Quote: ... The quality and concentration of the extracted RNA was measured with the Agilent RNA 6000 nano kit (Cat-No: 5067-1511, Agilent, Santa Clara, CA) on an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Cell Biology 2020Quote: pSecTagNC + ΔEGF_mN1 W1758A and pSecTagNC + ΔEGF_mN1 R1994A: these plasmids were generated by PCR-based mutagenesis using the QuikChange Lightning Multi Site-Directed mutagenesis kit (Stratagene, Santa Clara, USA) using pSecTagNC + ΔEGF_mN1 as a template and primers ...
-
bioRxiv - Cell Biology 2020Quote: pcDNA3 + mNICD R1994A: this plasmid was generated by PCR-based mutagenesis using the QuikChange Lightning Multi Site-Directed mutagenesis kit (Stratagene, Santa Clara, USA) using pcDNA3 + mNICD as a template and the primer A2026VmutF.
-
bioRxiv - Biochemistry 2019Quote: ... the G6b-B mutant with mutation in the potential heparin binding site (hG6b-B K54D/K58D/R60E/R61E referred to as hG6b-B-mut) was generated with the Quick Change Site-directed mutagenesis kit (Agilent Technologies, Stockport, UK).
-
bioRxiv - Systems Biology 2019Quote: ... Translating mRNA bound to the GFP-tagged ribosomal subunit protein L10a was then pulled-down and purified (Absolutely RNA Microprep Kit, Agilent Technologies, Wilmington, DE). RNA-Seq libraries were prepared from 1 μg of purified RNA using the NEBNext Ultra RNA Library Prep Kit for Illumina with NEBNext Poly(A ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The quality of RNA samples was analyzed using the RNA 6000 Pico Kit running on the 2100 BioAnalyzer (Agilent Santa Clara, California, US). Total RNA was diluted in a final volume of 50 μL for a total input of 1 μg ...
-
bioRxiv - Biophysics 2019Quote: ... We have demonstrated that attachment of the fluorescent proteins at these sites does not interfere with SERCA activity or PLB inhibition.25,26 PLB cDNA mutations were introduced using the QuikChange mutagenesis kit (Agilent Technologies, Santa Clara, CA), and all expression plasmids were sequenced for confirmation.
-
bioRxiv - Cell Biology 2019Quote: One-color microarray-based gene expression analysis was performed using a SurePrint G3 Human Gene Expression v3 8×60K Microarray Kit (Agilent, Santa Clara, CA) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: The eGFP-K17E construct for the mammalian expression of the SERF1a single-point mutant eGFP-K17E was generated by site-directed mutagenesis according to the QuickChange II mutagenesis kit manual (Agilent, Santa Clara, CA), using pEGFP/SERF1a (Tab ...
-
bioRxiv - Genomics 2020Quote: ... Chromium Genome Reagents Kit Version 2 User Guide) and size and concentration determined using an Agilent 2100 Bioanalyzer DNA 1000 chip (Agilent Technologies, CA, USA). Libraries were then sequenced on an Illumina NovaSeq 6000 System following the manufacturer’s protocols (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... 100 nucleotides) was verified by fluorescent capillary electrophoresis using an Agilent 2100 Bioanalyzer (Agilent RNA 6000 pico kit, Agilent, Santa Clara, CA, USA).
-
bioRxiv - Immunology 2021Quote: ... The concentration and quality of the RNA was determined by an Agilent 2100 Bioanalyzer with the Agilent RNA 6000 Pico Kit (Agilent Technologies, #5067-1513). The oligonucleotides used for the NGS were tabulated (Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA was eluted into 10 μL of nuclease free water and analyzed on Agilent 2100 Bioanalyzer using the RNA 6000 Pico kit (Agilent, catalog #5067-1513). For protein analysis ...
-
bioRxiv - Bioengineering 2020Quote: ... ENVs were collected 3 days after electroporation and analyzed for miR-101-3p content by RT-PCR using the qScript microRNA cDNA Synthesis Kit (Quanta Biosciences, Beverly, MA) and SYBR Mastermix (Quanta Biosciences) on a Stratagene Mx 3000 P (Stratagene, San Diego, CA). The primer for miR-101-3p was (TACAGTACTGTGATAACTGAA) ...
-
bioRxiv - Cancer Biology 2020Quote: Extracellular acidification rate (ECAR) was analyzed on a XF96 Extracellular Flux Analyzer using XF Glycolysis Stress Test Kit (Agilent Technology, Santa Clara, CA) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... We performed exome sequencing in the child with neonatal diabetes and his consanguineous parents using the Agilent SureSelect Human All Exon Kit (Agilent SureSelect v4, 50Mb). We analyzed the data with our established pipeline in the institute (Kuhnen ...
-
bioRxiv - Plant Biology 2020Quote: RNA sample concentration and purity was assessed using the DeNovix DS-11 spectrophotometer (DeNovix Inc., Wilmington, DE, USA) and concentration and integrity were assessed using the Agilent RNA 6000 Nano Kit (Agilent Technologies, Waldbronn, Germany) in conjunction with the Agilent 2100 Bioanalyzer software according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Following visualization and an estimation of the concentration using the High Sensitivity D1000 DNA Kit on the Agilent 2200 TapeStation system (Agilent Technologies, CA, USA), the samples were pooled according to concentration ...
-
bioRxiv - Genomics 2021Quote: ... Library quality control was performed using the 2100 Bioanalyzer System with the Agilent High Sensitivity DNA Kit (Agilent Technologies, Santa Clara, CA, USA). The libraries were individually quantified via qPCR using a KAPA Library Quantification Kits (Kapa Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... The average sample fragment length and purity was determined using Agilent High Sensitivity DNA kit and the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA). After passing quality control measures ...