Labshake search
Citations for Agilent :
601 - 650 of 1057 citations for S 3 Amino 4 4 cyanophenyl butanoic acid hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Antigen concentration was determined using a PLRP-S column (2.1 x 150 mm, 300Å, 3µm) operated at 0.6 mL/min and 80°C (Agilent Technologies, Santa Clara, CA) on an HPLC equipped with a diode array detector set for absorbance detection at 214nm and ...
-
bioRxiv - Bioengineering 2020Quote: ... Antigen concentration was determined using a PLRP-S column (2.1 x 150 mm, 300Å, 3μm) operated at 0.5 mL/min and 60°C (Agilent Technologies, Santa Clara, CA). Buffer A was 0.1% (v/v ...
-
bioRxiv - Microbiology 2022Quote: ... according to the manufacturer’s protocol and shipped in dry ice to the MDC/BIH Genomic Core Facility for quality assessment using TapeStation (Agilent Technologies). Libraries were prepared using TrueSeq Stranded mRNA kit to generate Illumina-compatible libraries by following the manufacturer’s protocol (Illumina) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL of sample was injected in a reverse phase column (Agilent PLRP-S 2.1 x 50 mm 100A 5 μm) held at 60 °C and eluted with a water-to-acetonitrile gradient from 95% to 50% water ...
-
bioRxiv - Immunology 2022Quote: ... for 120 s and separated by a C-18 column (Zorbax 300SB 2.1 × 50 mm, 3.5 μm particle diameter, Agilent, Santa Clara, CA). For LC ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were submitted to the Stanford Protein and Nucleic Acid Facility for quality assessment by Agilent Bioanalyzer to determine the RNA integrity (RIN ...
-
bioRxiv - Microbiology 2022Quote: ... Separation of bile acids was performed on a 1290 series HPLC from Agilent (Santa Clara, CA) using an Agilent SB-C18 2.1X100mm 1.8 µm column with a 2.1X5mm 1.8um guard column ...
-
bioRxiv - Cancer Biology 2021Quote: ... acidified with formic acid and subsequently desalted using AssayMap C18 cartridges (Agilent, Santa Clara, CA, USA) mounted on an Agilent AssayMap BRAVO liquid handling system ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase A consisted of water with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Cancer Biology 2022Quote: We used the Seahorse XF Long Chain Fatty Acid Oxidation Stress Test kit (Agilent, 102720-100). Cells were incubated in assay media supplemented with 150 µM BSA or oleic acid conjugated to BSA as fatty acid substrate in the following formulation ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The concentrations of glucose and organic acids were detected by a HPLC (Agilent 1260, Waldbronn, Germany) equipped with a refractive index detector (RID) ...
-
bioRxiv - Immunology 2021Quote: ... Quality and integrity of nucleic acids were assessed using the Agilent Technologies 2100 Bioanalyzer (Agilent Technologies) after each step ...
-
bioRxiv - Synthetic Biology 2023Quote: The residual glucose and organic acids were analyzed using high performance liquid chromatography (HPLC, Agilent, USA) equipped with a refractive index detector (RID ...
-
bioRxiv - Biochemistry 2023Quote: ... the bile acids identified were analyzed by Mass Hunter Qualitative 10.0 qualitative (Version B.10.0, Agilent software metabolomics ...
-
bioRxiv - Cancer Biology 2024Quote: ... 30 mM ammonium acetate (NH4Ac) (aq) + 0.1% formic acid (FA) + 0.0015% InfinityLab Deactivator (Agilent Technologies, Inc.) in 1% MeOH ...
-
bioRxiv - Microbiology 2024Quote: ... Filtered samples (0.22 nitrocellulose filter) were analyzed for glucose and acetate acid using HPLC (Agilent 1260) with a refractive index detector and with a reverse-phase column C18 (Waters ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed with a 3-laser flow cytometer (Agilent Novocyte) and data were processed with FlowJo (v10.1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luminescence was measured using a Cytation 3 Image Reader (Agilent). The luminescence of vehicle-treated controls was set to 100% ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luciferase activities were measured with Cytation 3 Image Reader (Agilent). Firefly luciferase activities were normalized to those of the Renilla luciferase.
-
bioRxiv - Cancer Biology 2024Quote: ... Absorbase (450nm) was red with BioTek Cytation 3 (Agilent, California, US).
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was quantified using the Gen5 Take 3 Module (Agilent BioTek) and assessed for quality with 260/230 absorbance ratio ...
-
bioRxiv - Cancer Biology 2021Quote: ... cGAMP was purified from the reaction mixture using a PLRP-S polymeric reversed phase preparatory column (100 Å, 8 μm, 300 × 25 mm; Agilent Technologies) on a preparatory HPLC (1260 Infinity LC system ...
-
bioRxiv - Immunology 2021Quote: ... cGAMP was purified from the reaction mixture using a PLRP-S polymeric reversed phase preparatory column (100 Å, 8 μm, 300 x 25 mm; Agilent Technologies) on a preparatory HPLC (1260 Infinity LC system ...
-
bioRxiv - Biochemistry 2023Quote: ... The average results of each element’s concentration were calculated for triplicate or duplicate measurements using MassHunter 4.1 Workstation Software for 7700 ICP-MS (Agilent Technologies Inc. 2015).
-
bioRxiv - Microbiology 2023Quote: Plasmids encoding hexahistidine (Hisx6)- and glutathione S-transferase (GST)-tagged proteins were introduced into Escherichia coli strain BL21(DE3) CondonPlus RIL (230245, Agilent Technologies, Inc.), and the expression of the recombinant protein was induced by 0.5 mM isopropylthio-β-D-galactoside (IPTG ...
-
bioRxiv - Cancer Biology 2023Quote: ... cGAMP was purified from the reaction mixture using a PLRP-S polymeric reversed phase preparatory column (100 Å, 8 μm, 300 x 25 mm; Agilent Technologies) on a preparatory HPLC (1260 Infinity LC system ...
-
bioRxiv - Genomics 2021Quote: ... Quality and size distribution of the captured genomic segments were verified by TapStation nucleic acids system (Agilent) assessments of regular or bisulfite-converted libraries ...
-
bioRxiv - Neuroscience 2021Quote: ... Periodic acid-Schiff staining (PAS) was performed using an Artisanlink Pro machine (AR16511-2 kit, Dako-Agilent).
-
bioRxiv - Neuroscience 2021Quote: ... Periodic acid-Schiff staining (PAS) was performed using an Artisanlink Pro machine (AR16511-2 kit, Dako-Agilent).
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were acidified with 1% formic acid (FA) and purified using OMIX C18 Mini-Bed tips (Agilent) prior to LC-MS/MS analysis.
-
bioRxiv - Neuroscience 2023Quote: ... and β-amyloid analysis (pretreatment with formic acid, antibody 4G8, DAKO, M087201-2, 1:100, 30 minutes). Tau pathology was assessed using Braak criteria (Braak et al ...
-
bioRxiv - Physiology 2024Quote: ... Total bile acids assay (Diazyme Laboratories, CA, USA) and BioTek Epoch Microplate Spectrophotometer (Agilent Technologies, CA, USA) were used to measure total BA concentrations to determine the volume of cholestyramine-untreated extract needed to add for a final concentration of ∼300 μM BAs in the ileal explant culture media ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a (C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). The photoproducts of DEAC-OXM were generated and analyzed in an analogous manner ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). Each compound was assessed in triplicate ...
-
bioRxiv - Microbiology 2023Quote: ... Cellular fatty acids were extracted and determined from dried cells by using GC (model 7890A, Agilent, USA) according to the protocol of the Sherlock Microbial Identification System (61) ...
-
bioRxiv - Biochemistry 2024Quote: ... Bond Elut PBA (phenylboronic acid) cartridge and 96-well plate were purchased from Agilent (Santa Clara, USA). 1 µM of q and Q was spiked in human plasma and extracted with SPE cartridges ...
-
bioRxiv - Cell Biology 2024Quote: The Peptide nucleic acid (PNA) probe hybridisation of chromosome spreads followed the manufacturers guidelines (DAKO Agilent & PNAbio). Chromosome spreads were fixed in 3.7% PFA and washed using a gradient ice-cold ethanol wash series 70% ...
-
bioRxiv - Cell Biology 2024Quote: The Peptide nucleic acid (PNA) probe hybridisation of chromosome spreads followed the manufacturers guidelines (DAKO Agilent & PNAbio). Chromosome spreads were fixed in 3.7% PFA and washed using a gradient ice-cold ethanol wash series 70% ...
-
bioRxiv - Microbiology 2024Quote: ... and dispensed 30% acetic acid using the BioTek EL406 microplate washer/dispenser (Agilent, Santa Clara, CA, USA). The absorbance of CV-stained biofilms was recorded at 590 nm ...
-
bioRxiv - Molecular Biology 2020Quote: ... The size distribution and concentration of s-mEV miRNA was further assessed using a 2100 Agilent Bioanalyzer with an Agilent Small RNA Kit (Agilent Technologies, CA, USA), according to the manufacturers’ instruction.
-
bioRxiv - Microbiology 2021Quote: ... This clone was then used to generate single or multiple mutations in the RBD of S gene with site-directed mutagenesis kit (Agilent, Santa Clara, CA) using primers listed in the supplemental Table 2 and designated as pAbVec-SARS2-S (mutant) ...
-
bioRxiv - Pathology 2022Quote: ... and a monoclonal antibody directed against the alpha isoform of smooth muscle actin at a working dilution of 1/100 (a-SMA, clone 1A4, n M0851; Dako, Denmark A/S). Alligator skeletal muscle was used as positive control for anti-desmin antibody (Supplemental figure 3A) ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Cell Biology 2022Quote: ... grown cells were blocked with 1x PBS containing 3% goat serum (DAKO) for 30 min at RT ...
-
bioRxiv - Neuroscience 2022Quote: ... and goat-anti-mouse IG (Dako, P0447, 1:3000 in 3% milk) antibodies were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... for cleaved Caspase-3 and HRP labeled polymer and DAB chromagen (Dako) for PCNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... Staining was performed following the epitope retrieval process using VectaStain Kit from Vector Labs for cleaved Caspase-3 and horseradish peroxidase-labeled polymer from Dako (K4001) for PCNA ...
-
bioRxiv - Biochemistry 2023Quote: ... The free HSF2BP protein was analyzed using a BIOSEC 3 column (Agilent) equilibrated in 25 mM Tris-HCl pH 7.5 ...